FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641131_at:

>probe:Drosophila_2:1641131_at:553:463; Interrogation_Position=3062; Antisense; GATTCGTTTCATCAGCTTCCCAGAA
>probe:Drosophila_2:1641131_at:67:241; Interrogation_Position=3105; Antisense; AATACATTCACCACCTTTTCATTTG
>probe:Drosophila_2:1641131_at:341:467; Interrogation_Position=3168; Antisense; GTTGTCTACTACAATGCCTTGTTCA
>probe:Drosophila_2:1641131_at:141:457; Interrogation_Position=3205; Antisense; GATAGATTTCATCCGCATGCTACTT
>probe:Drosophila_2:1641131_at:57:695; Interrogation_Position=3228; Antisense; TTTCGCCCTTCCATCAGTAAAGAGT
>probe:Drosophila_2:1641131_at:318:257; Interrogation_Position=3261; Antisense; CATCAACACTTTCATATCGGCAGGT
>probe:Drosophila_2:1641131_at:302:343; Interrogation_Position=3288; Antisense; GCTTCAAGACGGAACTTCTCGACGA
>probe:Drosophila_2:1641131_at:606:409; Interrogation_Position=3308; Antisense; GACGAGATCCGCTTCATTTTACAAT
>probe:Drosophila_2:1641131_at:443:177; Interrogation_Position=3367; Antisense; AAACTCTTCGCGATCGAATGCCAGC
>probe:Drosophila_2:1641131_at:617:43; Interrogation_Position=3397; Antisense; ATCGAAAGGCTCTTCCATGTCAGTG
>probe:Drosophila_2:1641131_at:650:495; Interrogation_Position=3415; Antisense; GTCAGTGGATTCATTGCCCGAGGAT
>probe:Drosophila_2:1641131_at:97:457; Interrogation_Position=3437; Antisense; GATACCTCAGAAGCTGACGCATCTG
>probe:Drosophila_2:1641131_at:352:461; Interrogation_Position=3499; Antisense; GATTATATCGCTTGTTCACACAGTG
>probe:Drosophila_2:1641131_at:171:295; Interrogation_Position=3576; Antisense; CGAGTTCGCCGACTATCAGATAGTG

Paste this into a BLAST search page for me
GATTCGTTTCATCAGCTTCCCAGAAAATACATTCACCACCTTTTCATTTGGTTGTCTACTACAATGCCTTGTTCAGATAGATTTCATCCGCATGCTACTTTTTCGCCCTTCCATCAGTAAAGAGTCATCAACACTTTCATATCGGCAGGTGCTTCAAGACGGAACTTCTCGACGAGACGAGATCCGCTTCATTTTACAATAAACTCTTCGCGATCGAATGCCAGCATCGAAAGGCTCTTCCATGTCAGTGGTCAGTGGATTCATTGCCCGAGGATGATACCTCAGAAGCTGACGCATCTGGATTATATCGCTTGTTCACACAGTGCGAGTTCGCCGACTATCAGATAGTG

Full Affymetrix probeset data:

Annotations for 1641131_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720