FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641133_at:

>probe:Drosophila_2:1641133_at:588:169; Interrogation_Position=332; Antisense; AAAGGTGACCGCTAACATCACACCC
>probe:Drosophila_2:1641133_at:140:303; Interrogation_Position=355; Antisense; CCGCCAAGCCGAAGACTGAAGTCAA
>probe:Drosophila_2:1641133_at:391:143; Interrogation_Position=369; Antisense; ACTGAAGTCAAGCACAAGCTGGCGA
>probe:Drosophila_2:1641133_at:112:195; Interrogation_Position=415; Antisense; AACTGCAGGACCTTGAGGAGCCCGA
>probe:Drosophila_2:1641133_at:77:419; Interrogation_Position=456; Antisense; GAGCTGGAGCAGGAAATCGACCTCT
>probe:Drosophila_2:1641133_at:418:559; Interrogation_Position=467; Antisense; GGAAATCGACCTCTCACGCGTTGAG
>probe:Drosophila_2:1641133_at:662:619; Interrogation_Position=608; Antisense; TCGTGGCCAACGGAAACGGACTCCT
>probe:Drosophila_2:1641133_at:210:197; Interrogation_Position=622; Antisense; AACGGACTCCTTCGAAGCGCAGCGG
>probe:Drosophila_2:1641133_at:462:257; Interrogation_Position=648; Antisense; CACAAGCGGCGAACGGGCTCGAAAA
>probe:Drosophila_2:1641133_at:117:571; Interrogation_Position=663; Antisense; GGCTCGAAAACCAAGCGACAGGGTC
>probe:Drosophila_2:1641133_at:341:311; Interrogation_Position=705; Antisense; GCCAACAAGGAAGCTGTCGCGCCAT
>probe:Drosophila_2:1641133_at:143:121; Interrogation_Position=716; Antisense; AGCTGTCGCGCCATCAAACAAGGTG
>probe:Drosophila_2:1641133_at:192:161; Interrogation_Position=733; Antisense; ACAAGGTGGCCTAACGCGCTGGACA
>probe:Drosophila_2:1641133_at:547:281; Interrogation_Position=758; Antisense; CTCCCACCTACAAATGCAGCTTTAA

Paste this into a BLAST search page for me
AAAGGTGACCGCTAACATCACACCCCCGCCAAGCCGAAGACTGAAGTCAAACTGAAGTCAAGCACAAGCTGGCGAAACTGCAGGACCTTGAGGAGCCCGAGAGCTGGAGCAGGAAATCGACCTCTGGAAATCGACCTCTCACGCGTTGAGTCGTGGCCAACGGAAACGGACTCCTAACGGACTCCTTCGAAGCGCAGCGGCACAAGCGGCGAACGGGCTCGAAAAGGCTCGAAAACCAAGCGACAGGGTCGCCAACAAGGAAGCTGTCGCGCCATAGCTGTCGCGCCATCAAACAAGGTGACAAGGTGGCCTAACGCGCTGGACACTCCCACCTACAAATGCAGCTTTAA

Full Affymetrix probeset data:

Annotations for 1641133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720