FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641134_at:

>probe:Drosophila_2:1641134_at:469:105; Interrogation_Position=1011; Antisense; AGACAAGGCTGTCCAGGCGCTGAAC
>probe:Drosophila_2:1641134_at:49:299; Interrogation_Position=1028; Antisense; CGCTGAACTCCTTGTTTGGACACAA
>probe:Drosophila_2:1641134_at:193:623; Interrogation_Position=1097; Antisense; TGCTGGACAAGTCGCGTGCCACGTT
>probe:Drosophila_2:1641134_at:557:505; Interrogation_Position=1112; Antisense; GTGCCACGTTTCCATTGGGTTTCCT
>probe:Drosophila_2:1641134_at:638:299; Interrogation_Position=1140; Antisense; CGCCTCGTCGTACGTGTGCAATGGA
>probe:Drosophila_2:1641134_at:250:83; Interrogation_Position=1214; Antisense; AGGGCGTCAATCTGGGCTTCAGCGA
>probe:Drosophila_2:1641134_at:449:343; Interrogation_Position=1229; Antisense; GCTTCAGCGATGTGCGGTATCTGGT
>probe:Drosophila_2:1641134_at:427:509; Interrogation_Position=1271; Antisense; GTGCATACGCCGGTTTCAAGCTCGG
>probe:Drosophila_2:1641134_at:59:577; Interrogation_Position=1294; Antisense; GGCGACAAGCAGCATCTCATCAAAT
>probe:Drosophila_2:1641134_at:22:515; Interrogation_Position=1329; Antisense; GTGTCTGGCGAAGAACGTGCCCATT
>probe:Drosophila_2:1641134_at:60:705; Interrogation_Position=1352; Antisense; TTATGCTGGGCGTGCATGGACTGCA
>probe:Drosophila_2:1641134_at:620:133; Interrogation_Position=1390; Antisense; ACGCAGTTCAGTCCGGTGGTCTTGC
>probe:Drosophila_2:1641134_at:164:211; Interrogation_Position=1459; Antisense; AAGAATCTGTTCATGCGCGGAGCGA
>probe:Drosophila_2:1641134_at:697:601; Interrogation_Position=1536; Antisense; TGTTTACTGTTTGCACATCACTTGT

Paste this into a BLAST search page for me
AGACAAGGCTGTCCAGGCGCTGAACCGCTGAACTCCTTGTTTGGACACAATGCTGGACAAGTCGCGTGCCACGTTGTGCCACGTTTCCATTGGGTTTCCTCGCCTCGTCGTACGTGTGCAATGGAAGGGCGTCAATCTGGGCTTCAGCGAGCTTCAGCGATGTGCGGTATCTGGTGTGCATACGCCGGTTTCAAGCTCGGGGCGACAAGCAGCATCTCATCAAATGTGTCTGGCGAAGAACGTGCCCATTTTATGCTGGGCGTGCATGGACTGCAACGCAGTTCAGTCCGGTGGTCTTGCAAGAATCTGTTCATGCGCGGAGCGATGTTTACTGTTTGCACATCACTTGT

Full Affymetrix probeset data:

Annotations for 1641134_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720