FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641136_at:

>probe:Drosophila_2:1641136_at:122:31; Interrogation_Position=109; Antisense; ATAAACAAGGATGCCGTGATCACCC
>probe:Drosophila_2:1641136_at:554:513; Interrogation_Position=124; Antisense; GTGATCACCCGCGAGGATGTTAATC
>probe:Drosophila_2:1641136_at:149:547; Interrogation_Position=138; Antisense; GGATGTTAATCCTGCCGACGCCGAG
>probe:Drosophila_2:1641136_at:462:409; Interrogation_Position=154; Antisense; GACGCCGAGGGCAACTACCAATACG
>probe:Drosophila_2:1641136_at:86:29; Interrogation_Position=174; Antisense; ATACGCCTTCGAGACCAGCAATGGT
>probe:Drosophila_2:1641136_at:675:263; Interrogation_Position=189; Antisense; CAGCAATGGTATTCAGGCCCAGGAG
>probe:Drosophila_2:1641136_at:561:439; Interrogation_Position=211; Antisense; GAGGCCGGAAACGTCAATGGCATTA
>probe:Drosophila_2:1641136_at:123:707; Interrogation_Position=233; Antisense; TTAGCGGAAGCAGCTCTTACATCTC
>probe:Drosophila_2:1641136_at:212:143; Interrogation_Position=279; Antisense; ACTGACCTACGTCGCCGATGAAAAC
>probe:Drosophila_2:1641136_at:663:611; Interrogation_Position=297; Antisense; TGAAAACGGCTTCCAGCCTCAGGGC
>probe:Drosophila_2:1641136_at:356:151; Interrogation_Position=396; Antisense; ACAGCCCTAAATCCCCGATTGGATA
>probe:Drosophila_2:1641136_at:637:725; Interrogation_Position=414; Antisense; TTGGATACCCCATTCAAAGCCTAGT
>probe:Drosophila_2:1641136_at:608:49; Interrogation_Position=431; Antisense; AGCCTAGTCAGTGCTTTTGCTAAAC
>probe:Drosophila_2:1641136_at:443:441; Interrogation_Position=45; Antisense; GATGTTTAAGCTATCGCTCTGCCTG

Paste this into a BLAST search page for me
ATAAACAAGGATGCCGTGATCACCCGTGATCACCCGCGAGGATGTTAATCGGATGTTAATCCTGCCGACGCCGAGGACGCCGAGGGCAACTACCAATACGATACGCCTTCGAGACCAGCAATGGTCAGCAATGGTATTCAGGCCCAGGAGGAGGCCGGAAACGTCAATGGCATTATTAGCGGAAGCAGCTCTTACATCTCACTGACCTACGTCGCCGATGAAAACTGAAAACGGCTTCCAGCCTCAGGGCACAGCCCTAAATCCCCGATTGGATATTGGATACCCCATTCAAAGCCTAGTAGCCTAGTCAGTGCTTTTGCTAAACGATGTTTAAGCTATCGCTCTGCCTG

Full Affymetrix probeset data:

Annotations for 1641136_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720