FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641137_at:

>probe:Drosophila_2:1641137_at:672:549; Interrogation_Position=2033; Antisense; GGAGAAGAATTTGCACCCGATTCGA
>probe:Drosophila_2:1641137_at:347:129; Interrogation_Position=2047; Antisense; ACCCGATTCGAGCAATCGAACCTTG
>probe:Drosophila_2:1641137_at:47:297; Interrogation_Position=2063; Antisense; CGAACCTTGTATATAGCGAGAGCAA
>probe:Drosophila_2:1641137_at:639:715; Interrogation_Position=2162; Antisense; TTCGTTCGTTTGTTTCGCATAACCA
>probe:Drosophila_2:1641137_at:252:479; Interrogation_Position=2173; Antisense; GTTTCGCATAACCAATTGACAAAAG
>probe:Drosophila_2:1641137_at:427:297; Interrogation_Position=2201; Antisense; CGAACGGCATTCGTTTGCACAAAAT
>probe:Drosophila_2:1641137_at:97:693; Interrogation_Position=2287; Antisense; TTTGCAAAGTAAGTCAGTCTAGCTA
>probe:Drosophila_2:1641137_at:461:61; Interrogation_Position=2302; Antisense; AGTCTAGCTAATGGATCGATCGTGT
>probe:Drosophila_2:1641137_at:402:667; Interrogation_Position=2337; Antisense; TACTTCTAAGCACCTAAACTAAACT
>probe:Drosophila_2:1641137_at:298:239; Interrogation_Position=2362; Antisense; AATCTAATGCTATAACTATGCCGTT
>probe:Drosophila_2:1641137_at:4:117; Interrogation_Position=2393; Antisense; ACTTTACGATAATACCACAGACCTA
>probe:Drosophila_2:1641137_at:353:687; Interrogation_Position=2416; Antisense; TATACATATAGTTCATACACGCATT
>probe:Drosophila_2:1641137_at:548:129; Interrogation_Position=2456; Antisense; ACCATATAGCGTTAATCCTCTGTAG
>probe:Drosophila_2:1641137_at:705:45; Interrogation_Position=2470; Antisense; ATCCTCTGTAGTTGTTTAATCGTAA

Paste this into a BLAST search page for me
GGAGAAGAATTTGCACCCGATTCGAACCCGATTCGAGCAATCGAACCTTGCGAACCTTGTATATAGCGAGAGCAATTCGTTCGTTTGTTTCGCATAACCAGTTTCGCATAACCAATTGACAAAAGCGAACGGCATTCGTTTGCACAAAATTTTGCAAAGTAAGTCAGTCTAGCTAAGTCTAGCTAATGGATCGATCGTGTTACTTCTAAGCACCTAAACTAAACTAATCTAATGCTATAACTATGCCGTTACTTTACGATAATACCACAGACCTATATACATATAGTTCATACACGCATTACCATATAGCGTTAATCCTCTGTAGATCCTCTGTAGTTGTTTAATCGTAA

Full Affymetrix probeset data:

Annotations for 1641137_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720