Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641138_at:

>probe:Drosophila_2:1641138_at:694:47; Interrogation_Position=1035; Antisense; ATGCGAAAACTTATGCCGGACTTAT
>probe:Drosophila_2:1641138_at:404:685; Interrogation_Position=1057; Antisense; TATAGCCATGCTTACCACTGAGGTT
>probe:Drosophila_2:1641138_at:513:435; Interrogation_Position=1076; Antisense; GAGGTTGTATTCTTCCCTCTCGAAA
>probe:Drosophila_2:1641138_at:296:391; Interrogation_Position=1097; Antisense; GAAACCATATTGCATCGCCTAGAAC
>probe:Drosophila_2:1641138_at:338:81; Interrogation_Position=1125; Antisense; AGGGCACCCGAACCATAATCGATAA
>probe:Drosophila_2:1641138_at:390:667; Interrogation_Position=1156; Antisense; TACTGGTTATTCAGTTGTCCCGGTT
>probe:Drosophila_2:1641138_at:438:399; Interrogation_Position=1173; Antisense; TCCCGGTTTTGACAGACTATCGTGG
>probe:Drosophila_2:1641138_at:576:333; Interrogation_Position=1238; Antisense; GCTGCTGGACTCTACAAAGGCTTCG
>probe:Drosophila_2:1641138_at:491:71; Interrogation_Position=1255; Antisense; AGGCTTCGGAGCAATGATCCTTCAA
>probe:Drosophila_2:1641138_at:721:447; Interrogation_Position=1270; Antisense; GATCCTTCAATTTGTCGCACAGGTT
>probe:Drosophila_2:1641138_at:526:687; Interrogation_Position=1342; Antisense; TATATTGAATCGTCCAACATCCCGC
>probe:Drosophila_2:1641138_at:13:89; Interrogation_Position=1369; Antisense; AGTACAGCCCTACAATTTCGATTCC
>probe:Drosophila_2:1641138_at:497:309; Interrogation_Position=1426; Antisense; GCCAAGCATTTCCAGCATCGATGTG
>probe:Drosophila_2:1641138_at:296:69; Interrogation_Position=951; Antisense; ATGGCGTATCCACTCGAATGATGCA

Paste this into a BLAST search page for me
ATGCGAAAACTTATGCCGGACTTATTATAGCCATGCTTACCACTGAGGTTGAGGTTGTATTCTTCCCTCTCGAAAGAAACCATATTGCATCGCCTAGAACAGGGCACCCGAACCATAATCGATAATACTGGTTATTCAGTTGTCCCGGTTTCCCGGTTTTGACAGACTATCGTGGGCTGCTGGACTCTACAAAGGCTTCGAGGCTTCGGAGCAATGATCCTTCAAGATCCTTCAATTTGTCGCACAGGTTTATATTGAATCGTCCAACATCCCGCAGTACAGCCCTACAATTTCGATTCCGCCAAGCATTTCCAGCATCGATGTGATGGCGTATCCACTCGAATGATGCA

Full Affymetrix probeset data:

Annotations for 1641138_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime