FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641141_at:

>probe:Drosophila_2:1641141_at:604:51; Interrogation_Position=13; Antisense; ATGCACTTCAGGTCGTTGTTCTGGA
>probe:Drosophila_2:1641141_at:84:617; Interrogation_Position=14; Antisense; TGCACTTCAGGTCGTTGTTCTGGAG
>probe:Drosophila_2:1641141_at:61:357; Interrogation_Position=15; Antisense; GCACTTCAGGTCGTTGTTCTGGAGA
>probe:Drosophila_2:1641141_at:556:149; Interrogation_Position=17; Antisense; ACTTCAGGTCGTTGTTCTGGAGAGC
>probe:Drosophila_2:1641141_at:347:511; Interrogation_Position=278; Antisense; GTGAAGCACTGAACCTCCAAGTTAC
>probe:Drosophila_2:1641141_at:563:611; Interrogation_Position=279; Antisense; TGAAGCACTGAACCTCCAAGTTACT
>probe:Drosophila_2:1641141_at:6:377; Interrogation_Position=280; Antisense; GAAGCACTGAACCTCCAAGTTACTT
>probe:Drosophila_2:1641141_at:435:203; Interrogation_Position=281; Antisense; AAGCACTGAACCTCCAAGTTACTTT
>probe:Drosophila_2:1641141_at:112:627; Interrogation_Position=293; Antisense; TCCAAGTTACTTTATATATACTGCT
>probe:Drosophila_2:1641141_at:273:375; Interrogation_Position=55; Antisense; GAAGACCGATTAGGGGATCCAGCTG
>probe:Drosophila_2:1641141_at:704:545; Interrogation_Position=69; Antisense; GGATCCAGCTGGCTACATACGCAAC
>probe:Drosophila_2:1641141_at:165:49; Interrogation_Position=71; Antisense; ATCCAGCTGGCTACATACGCAACCA
>probe:Drosophila_2:1641141_at:20:263; Interrogation_Position=74; Antisense; CAGCTGGCTACATACGCAACCAGAT
>probe:Drosophila_2:1641141_at:709:119; Interrogation_Position=75; Antisense; AGCTGGCTACATACGCAACCAGATG

Paste this into a BLAST search page for me
ATGCACTTCAGGTCGTTGTTCTGGATGCACTTCAGGTCGTTGTTCTGGAGGCACTTCAGGTCGTTGTTCTGGAGAACTTCAGGTCGTTGTTCTGGAGAGCGTGAAGCACTGAACCTCCAAGTTACTGAAGCACTGAACCTCCAAGTTACTGAAGCACTGAACCTCCAAGTTACTTAAGCACTGAACCTCCAAGTTACTTTTCCAAGTTACTTTATATATACTGCTGAAGACCGATTAGGGGATCCAGCTGGGATCCAGCTGGCTACATACGCAACATCCAGCTGGCTACATACGCAACCACAGCTGGCTACATACGCAACCAGATAGCTGGCTACATACGCAACCAGATG

Full Affymetrix probeset data:

Annotations for 1641141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720