FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641142_at:

>probe:Drosophila_2:1641142_at:494:719; Interrogation_Position=422; Antisense; TTGCCGAATGCAAAGCCCACGATTA
>probe:Drosophila_2:1641142_at:474:709; Interrogation_Position=444; Antisense; TTAAGACATCCATTTCATCCTACTG
>probe:Drosophila_2:1641142_at:11:183; Interrogation_Position=504; Antisense; AAAACGCAGCTTTAGGGCAGACCAA
>probe:Drosophila_2:1641142_at:585:251; Interrogation_Position=572; Antisense; CAACCAGTAAGCCAAGATCCCGATA
>probe:Drosophila_2:1641142_at:437:311; Interrogation_Position=689; Antisense; GCCAGCAAGGCATCCGGTCAGGAGA
>probe:Drosophila_2:1641142_at:319:727; Interrogation_Position=714; Antisense; TTGTCAGTGCCTTAGAGGGCGGCCA
>probe:Drosophila_2:1641142_at:357:309; Interrogation_Position=736; Antisense; CCAGCTGTCTACCAATGATCACGAG
>probe:Drosophila_2:1641142_at:189:455; Interrogation_Position=752; Antisense; GATCACGAGAATGCGGCTTCCATTT
>probe:Drosophila_2:1641142_at:344:121; Interrogation_Position=777; Antisense; AGCCGTCTTCAACTAACACTAATCA
>probe:Drosophila_2:1641142_at:695:255; Interrogation_Position=800; Antisense; CAAACCCGATGTCTAGTATCTCTAC
>probe:Drosophila_2:1641142_at:355:483; Interrogation_Position=815; Antisense; GTATCTCTACCGATCTCGAGGCAAA
>probe:Drosophila_2:1641142_at:340:529; Interrogation_Position=857; Antisense; GGGAGCTGATTCAACCTTACACAAT
>probe:Drosophila_2:1641142_at:232:153; Interrogation_Position=897; Antisense; ACATCCCTGCTAACTGACATACATA
>probe:Drosophila_2:1641142_at:165:179; Interrogation_Position=929; Antisense; AAACATTTTCGCTTTGATTCCACAA

Paste this into a BLAST search page for me
TTGCCGAATGCAAAGCCCACGATTATTAAGACATCCATTTCATCCTACTGAAAACGCAGCTTTAGGGCAGACCAACAACCAGTAAGCCAAGATCCCGATAGCCAGCAAGGCATCCGGTCAGGAGATTGTCAGTGCCTTAGAGGGCGGCCACCAGCTGTCTACCAATGATCACGAGGATCACGAGAATGCGGCTTCCATTTAGCCGTCTTCAACTAACACTAATCACAAACCCGATGTCTAGTATCTCTACGTATCTCTACCGATCTCGAGGCAAAGGGAGCTGATTCAACCTTACACAATACATCCCTGCTAACTGACATACATAAAACATTTTCGCTTTGATTCCACAA

Full Affymetrix probeset data:

Annotations for 1641142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720