FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641146_at:

>probe:Drosophila_2:1641146_at:55:249; Interrogation_Position=1594; Antisense; AATTGAGCCCCTGATATTCGTCATA
>probe:Drosophila_2:1641146_at:402:9; Interrogation_Position=1609; Antisense; ATTCGTCATAATCTGCTACTGGCTG
>probe:Drosophila_2:1641146_at:274:601; Interrogation_Position=1632; Antisense; TGACGGGTCTGAGATCCACCTTTTA
>probe:Drosophila_2:1641146_at:97:705; Interrogation_Position=1654; Antisense; TTATGCCTTCGGAGTGACTGCCATG
>probe:Drosophila_2:1641146_at:190:229; Interrogation_Position=1756; Antisense; AATGGCTTACTTGGTGCCCTTGGAT
>probe:Drosophila_2:1641146_at:185:455; Interrogation_Position=1792; Antisense; GATCACCTCGGGAATCTTTATACAA
>probe:Drosophila_2:1641146_at:3:511; Interrogation_Position=1817; Antisense; GTGAATTCGCTACCAGTGGCGTTTT
>probe:Drosophila_2:1641146_at:202:533; Interrogation_Position=1842; Antisense; GGTGGACACAATTTCTCTCATGGAT
>probe:Drosophila_2:1641146_at:676:231; Interrogation_Position=1885; Antisense; AATGACCGCTGCTCAATGGTCTGGA
>probe:Drosophila_2:1641146_at:320:75; Interrogation_Position=1932; Antisense; AGGAGAGTGCCGACTTGCCGTGCTT
>probe:Drosophila_2:1641146_at:686:273; Interrogation_Position=1954; Antisense; CTTTCACACGGGTCAGGATGTCCTG
>probe:Drosophila_2:1641146_at:236:231; Interrogation_Position=2003; Antisense; AATGTCTATCGGAATTTACTGGCCA
>probe:Drosophila_2:1641146_at:419:313; Interrogation_Position=2024; Antisense; GCCATGGTGGGTCTTTATTTCGGAT
>probe:Drosophila_2:1641146_at:135:143; Interrogation_Position=2056; Antisense; ACTGGGATATTATTGCCTTTGGCGA

Paste this into a BLAST search page for me
AATTGAGCCCCTGATATTCGTCATAATTCGTCATAATCTGCTACTGGCTGTGACGGGTCTGAGATCCACCTTTTATTATGCCTTCGGAGTGACTGCCATGAATGGCTTACTTGGTGCCCTTGGATGATCACCTCGGGAATCTTTATACAAGTGAATTCGCTACCAGTGGCGTTTTGGTGGACACAATTTCTCTCATGGATAATGACCGCTGCTCAATGGTCTGGAAGGAGAGTGCCGACTTGCCGTGCTTCTTTCACACGGGTCAGGATGTCCTGAATGTCTATCGGAATTTACTGGCCAGCCATGGTGGGTCTTTATTTCGGATACTGGGATATTATTGCCTTTGGCGA

Full Affymetrix probeset data:

Annotations for 1641146_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720