Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641152_at:

>probe:Drosophila_2:1641152_at:324:155; Interrogation_Position=5190; Antisense; ACACCACATGGCTTCTTTTTAACGG
>probe:Drosophila_2:1641152_at:383:13; Interrogation_Position=5205; Antisense; TTTTTAACGGGCTTCTTGCTTCCTG
>probe:Drosophila_2:1641152_at:308:385; Interrogation_Position=5302; Antisense; GAACATCCTATTTCTCATACACGAC
>probe:Drosophila_2:1641152_at:116:355; Interrogation_Position=5328; Antisense; GCACTCGGAGTAGTTAACCTGTCAT
>probe:Drosophila_2:1641152_at:252:263; Interrogation_Position=5426; Antisense; CAGCTGCATGCGTATATTCCTTAAA
>probe:Drosophila_2:1641152_at:396:321; Interrogation_Position=5481; Antisense; GCCCTGAATGCCGAGCTGATGCTAA
>probe:Drosophila_2:1641152_at:666:443; Interrogation_Position=5498; Antisense; GATGCTAACCGTGCTATGTTTGTTC
>probe:Drosophila_2:1641152_at:515:589; Interrogation_Position=5514; Antisense; TGTTTGTTCTTTCTTTTTCCTTATG
>probe:Drosophila_2:1641152_at:104:245; Interrogation_Position=5540; Antisense; AATTTGTCACTCCTATATCCAGTCG
>probe:Drosophila_2:1641152_at:112:673; Interrogation_Position=5555; Antisense; TATCCAGTCGCCTCTCGGAATTGAG
>probe:Drosophila_2:1641152_at:162:477; Interrogation_Position=5610; Antisense; GTTTTGAACCAACTACCTGAGCGGG
>probe:Drosophila_2:1641152_at:495:291; Interrogation_Position=5637; Antisense; CGTTACGATCCGATTTTCACCTGAT
>probe:Drosophila_2:1641152_at:256:711; Interrogation_Position=5652; Antisense; TTCACCTGATCTTACACTCACAGAT
>probe:Drosophila_2:1641152_at:466:25; Interrogation_Position=5724; Antisense; ATAGTTTCTAAGCTCGACCTGACAA

Paste this into a BLAST search page for me
ACACCACATGGCTTCTTTTTAACGGTTTTTAACGGGCTTCTTGCTTCCTGGAACATCCTATTTCTCATACACGACGCACTCGGAGTAGTTAACCTGTCATCAGCTGCATGCGTATATTCCTTAAAGCCCTGAATGCCGAGCTGATGCTAAGATGCTAACCGTGCTATGTTTGTTCTGTTTGTTCTTTCTTTTTCCTTATGAATTTGTCACTCCTATATCCAGTCGTATCCAGTCGCCTCTCGGAATTGAGGTTTTGAACCAACTACCTGAGCGGGCGTTACGATCCGATTTTCACCTGATTTCACCTGATCTTACACTCACAGATATAGTTTCTAAGCTCGACCTGACAA

Full Affymetrix probeset data:

Annotations for 1641152_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime