Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641154_at:

>probe:Drosophila_2:1641154_at:281:69; Interrogation_Position=2366; Antisense; ATGGCGCCCGGAATTGATATGCTGC
>probe:Drosophila_2:1641154_at:37:459; Interrogation_Position=2381; Antisense; GATATGCTGCATCATTTTGGGCCGC
>probe:Drosophila_2:1641154_at:651:7; Interrogation_Position=2437; Antisense; ATTGCTGGACGCCAACGCTGGAAAC
>probe:Drosophila_2:1641154_at:341:543; Interrogation_Position=2464; Antisense; GGATAGTTTTGATTACAGCCGCTTT
>probe:Drosophila_2:1641154_at:131:665; Interrogation_Position=2477; Antisense; TACAGCCGCTTTAGACGACACTTTG
>probe:Drosophila_2:1641154_at:719:153; Interrogation_Position=2494; Antisense; ACACTTTGCTACACTTTTCGACAGG
>probe:Drosophila_2:1641154_at:472:465; Interrogation_Position=2518; Antisense; GATTGTGAGATTAGCCTCCTCTCCA
>probe:Drosophila_2:1641154_at:19:641; Interrogation_Position=2537; Antisense; TCTCCAGTGGCAGTTAACCCCGAAA
>probe:Drosophila_2:1641154_at:424:549; Interrogation_Position=2584; Antisense; GGAGGAGAAGCTACCGCCGACACAG
>probe:Drosophila_2:1641154_at:591:189; Interrogation_Position=2687; Antisense; AACATGAGCAGCTCCCTGGAGGCAG
>probe:Drosophila_2:1641154_at:170:453; Interrogation_Position=2741; Antisense; GATCTTCGCGAGGATGTGGGCTATC
>probe:Drosophila_2:1641154_at:622:75; Interrogation_Position=2856; Antisense; AGGAGCTATTCAGCGACCTGGGCAT
>probe:Drosophila_2:1641154_at:651:483; Interrogation_Position=2887; Antisense; GTAGGCTTGGACGACTTGGAACTTG
>probe:Drosophila_2:1641154_at:456:385; Interrogation_Position=2905; Antisense; GAACTTGGGTTATTCTCGTCGCAAT

Paste this into a BLAST search page for me
ATGGCGCCCGGAATTGATATGCTGCGATATGCTGCATCATTTTGGGCCGCATTGCTGGACGCCAACGCTGGAAACGGATAGTTTTGATTACAGCCGCTTTTACAGCCGCTTTAGACGACACTTTGACACTTTGCTACACTTTTCGACAGGGATTGTGAGATTAGCCTCCTCTCCATCTCCAGTGGCAGTTAACCCCGAAAGGAGGAGAAGCTACCGCCGACACAGAACATGAGCAGCTCCCTGGAGGCAGGATCTTCGCGAGGATGTGGGCTATCAGGAGCTATTCAGCGACCTGGGCATGTAGGCTTGGACGACTTGGAACTTGGAACTTGGGTTATTCTCGTCGCAAT

Full Affymetrix probeset data:

Annotations for 1641154_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime