FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641155_at:

>probe:Drosophila_2:1641155_at:249:433; Interrogation_Position=304; Antisense; GAGGGTAAGCCTTTTCCACACATAC
>probe:Drosophila_2:1641155_at:550:445; Interrogation_Position=330; Antisense; GATGCACCCGATCACAAACATACAC
>probe:Drosophila_2:1641155_at:166:63; Interrogation_Position=357; Antisense; ATGTGCAGCACATCATGCAGTTGCG
>probe:Drosophila_2:1641155_at:427:269; Interrogation_Position=370; Antisense; CATGCAGTTGCGCTTTCTAAATCAA
>probe:Drosophila_2:1641155_at:639:177; Interrogation_Position=404; Antisense; AAACTGGCGGCTACGTTGACAAAGT
>probe:Drosophila_2:1641155_at:130:93; Interrogation_Position=426; Antisense; AGTTCAAGTCGCATGTGGGCAGCAT
>probe:Drosophila_2:1641155_at:259:517; Interrogation_Position=440; Antisense; GTGGGCAGCATTACTTGGCCAGTAG
>probe:Drosophila_2:1641155_at:648:665; Interrogation_Position=451; Antisense; TACTTGGCCAGTAGTTACCGTTGTC
>probe:Drosophila_2:1641155_at:69:673; Interrogation_Position=466; Antisense; TACCGTTGTCTTTCAAAGTGGCCGA
>probe:Drosophila_2:1641155_at:510:219; Interrogation_Position=481; Antisense; AAGTGGCCGATTGCCATAATTGGCA
>probe:Drosophila_2:1641155_at:714:565; Interrogation_Position=502; Antisense; GGCAACAGCGCCAATGTTATTGTTA
>probe:Drosophila_2:1641155_at:583:33; Interrogation_Position=536; Antisense; ATCAAGTCTCAATACGCACACACAC
>probe:Drosophila_2:1641155_at:543:155; Interrogation_Position=561; Antisense; ACACGCGTTCCCATTGCAAACAGCT
>probe:Drosophila_2:1641155_at:577:179; Interrogation_Position=578; Antisense; AAACAGCTGTGCGTGGTACGGCAAT

Paste this into a BLAST search page for me
GAGGGTAAGCCTTTTCCACACATACGATGCACCCGATCACAAACATACACATGTGCAGCACATCATGCAGTTGCGCATGCAGTTGCGCTTTCTAAATCAAAAACTGGCGGCTACGTTGACAAAGTAGTTCAAGTCGCATGTGGGCAGCATGTGGGCAGCATTACTTGGCCAGTAGTACTTGGCCAGTAGTTACCGTTGTCTACCGTTGTCTTTCAAAGTGGCCGAAAGTGGCCGATTGCCATAATTGGCAGGCAACAGCGCCAATGTTATTGTTAATCAAGTCTCAATACGCACACACACACACGCGTTCCCATTGCAAACAGCTAAACAGCTGTGCGTGGTACGGCAAT

Full Affymetrix probeset data:

Annotations for 1641155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720