FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641156_at:

>probe:Drosophila_2:1641156_at:355:555; Interrogation_Position=103; Antisense; GGACCTGCAGATGGAGTTCGCCACA
>probe:Drosophila_2:1641156_at:395:719; Interrogation_Position=119; Antisense; TTCGCCACACGCATCGCCATGGAAT
>probe:Drosophila_2:1641156_at:440:585; Interrogation_Position=138; Antisense; TGGAATCGCAGCTTGGCGATACCCT
>probe:Drosophila_2:1641156_at:477:727; Interrogation_Position=150; Antisense; TTGGCGATACCCTCAAGTCCAGGCT
>probe:Drosophila_2:1641156_at:524:219; Interrogation_Position=164; Antisense; AAGTCCAGGCTTCGCATCTCGAATG
>probe:Drosophila_2:1641156_at:610:71; Interrogation_Position=170; Antisense; AGGCTTCGCATCTCGAATGCCCAGA
>probe:Drosophila_2:1641156_at:309:39; Interrogation_Position=179; Antisense; ATCTCGAATGCCCAGACCACGGACA
>probe:Drosophila_2:1641156_at:552:565; Interrogation_Position=206; Antisense; GGCAACTACACGTGTCAGCCAACGA
>probe:Drosophila_2:1641156_at:649:157; Interrogation_Position=213; Antisense; ACACGTGTCAGCCAACGACGGCCAG
>probe:Drosophila_2:1641156_at:171:197; Interrogation_Position=226; Antisense; AACGACGGCCAGCAGCGCCAGTGTC
>probe:Drosophila_2:1641156_at:187:309; Interrogation_Position=243; Antisense; CCAGTGTCCTGGTCCATGTGATTAA
>probe:Drosophila_2:1641156_at:728:511; Interrogation_Position=260; Antisense; GTGATTAATGGTGAGTCCTGGGAAT
>probe:Drosophila_2:1641156_at:497:399; Interrogation_Position=71; Antisense; GACACGTCCCCGAATGACATAATGA
>probe:Drosophila_2:1641156_at:52:401; Interrogation_Position=86; Antisense; GACATAATGAGCGAGGTGGACCTGC

Paste this into a BLAST search page for me
GGACCTGCAGATGGAGTTCGCCACATTCGCCACACGCATCGCCATGGAATTGGAATCGCAGCTTGGCGATACCCTTTGGCGATACCCTCAAGTCCAGGCTAAGTCCAGGCTTCGCATCTCGAATGAGGCTTCGCATCTCGAATGCCCAGAATCTCGAATGCCCAGACCACGGACAGGCAACTACACGTGTCAGCCAACGAACACGTGTCAGCCAACGACGGCCAGAACGACGGCCAGCAGCGCCAGTGTCCCAGTGTCCTGGTCCATGTGATTAAGTGATTAATGGTGAGTCCTGGGAATGACACGTCCCCGAATGACATAATGAGACATAATGAGCGAGGTGGACCTGC

Full Affymetrix probeset data:

Annotations for 1641156_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720