FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641157_at:

>probe:Drosophila_2:1641157_at:267:209; Interrogation_Position=1035; Antisense; AAGCAAGAGGCTCAGTTCGTCGCGC
>probe:Drosophila_2:1641157_at:91:411; Interrogation_Position=1073; Antisense; GACGCCGTTCCGAGCTGATAAGATC
>probe:Drosophila_2:1641157_at:522:455; Interrogation_Position=1089; Antisense; GATAAGATCGATTCCCACGGTTCAA
>probe:Drosophila_2:1641157_at:415:257; Interrogation_Position=1104; Antisense; CACGGTTCAAGGACACGATGCTAGT
>probe:Drosophila_2:1641157_at:224:679; Interrogation_Position=1125; Antisense; TAGTGCTAGTGTGAACTTCGCCGGC
>probe:Drosophila_2:1641157_at:670:281; Interrogation_Position=1173; Antisense; CTCCGATTGATCTGGCTTGTTATGC
>probe:Drosophila_2:1641157_at:473:217; Interrogation_Position=1240; Antisense; AAGTTCAACTAGCTACTCGATGTGT
>probe:Drosophila_2:1641157_at:20:413; Interrogation_Position=1324; Antisense; GATCCGCCGACTGACGAAACTAAAT
>probe:Drosophila_2:1641157_at:407:345; Interrogation_Position=776; Antisense; GCATTCTGCGATCCTCGGGTATGAA
>probe:Drosophila_2:1641157_at:85:103; Interrogation_Position=806; Antisense; AGAGCTTGCTGGAGCGTATTGGCCA
>probe:Drosophila_2:1641157_at:503:315; Interrogation_Position=857; Antisense; GCCTTTTGCTCATCCAACTAGTGTG
>probe:Drosophila_2:1641157_at:666:97; Interrogation_Position=902; Antisense; AGATGCACCTGACCCTGCAGAGGAG
>probe:Drosophila_2:1641157_at:165:101; Interrogation_Position=920; Antisense; AGAGGAGTCACTTGCTGGAACGCGA
>probe:Drosophila_2:1641157_at:305:379; Interrogation_Position=937; Antisense; GAACGCGAGATACTGCAGCTTTTCC

Paste this into a BLAST search page for me
AAGCAAGAGGCTCAGTTCGTCGCGCGACGCCGTTCCGAGCTGATAAGATCGATAAGATCGATTCCCACGGTTCAACACGGTTCAAGGACACGATGCTAGTTAGTGCTAGTGTGAACTTCGCCGGCCTCCGATTGATCTGGCTTGTTATGCAAGTTCAACTAGCTACTCGATGTGTGATCCGCCGACTGACGAAACTAAATGCATTCTGCGATCCTCGGGTATGAAAGAGCTTGCTGGAGCGTATTGGCCAGCCTTTTGCTCATCCAACTAGTGTGAGATGCACCTGACCCTGCAGAGGAGAGAGGAGTCACTTGCTGGAACGCGAGAACGCGAGATACTGCAGCTTTTCC

Full Affymetrix probeset data:

Annotations for 1641157_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720