Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641160_s_at:

>probe:Drosophila_2:1641160_s_at:196:589; Interrogation_Position=516; Antisense; TGGAGTTCGTGCAGTGCCTGTCGAA
>probe:Drosophila_2:1641160_s_at:29:597; Interrogation_Position=534; Antisense; TGTCGAACCCCAACTATCTAAACTT
>probe:Drosophila_2:1641160_s_at:271:685; Interrogation_Position=548; Antisense; TATCTAAACTTCCTTGCACAGCGTG
>probe:Drosophila_2:1641160_s_at:270:617; Interrogation_Position=562; Antisense; TGCACAGCGTGGATTTTTCAAGGAC
>probe:Drosophila_2:1641160_s_at:86:251; Interrogation_Position=580; Antisense; CAAGGACCAGTCGTTCATCAACTAC
>probe:Drosophila_2:1641160_s_at:719:223; Interrogation_Position=626; Antisense; AAGGAGCCGGACTATGCGAAATACC
>probe:Drosophila_2:1641160_s_at:295:163; Interrogation_Position=644; Antisense; AAATACCTCATGTACCCAATGTGCC
>probe:Drosophila_2:1641160_s_at:645:83; Interrogation_Position=690; Antisense; AGTACGAACACTTCCGCCGGGAGAT
>probe:Drosophila_2:1641160_s_at:243:97; Interrogation_Position=711; Antisense; AGATCGTCAACTCGCAGTGCTGCAA
>probe:Drosophila_2:1641160_s_at:449:361; Interrogation_Position=732; Antisense; GCAAGTTCATAGACGACCAGGCCAT
>probe:Drosophila_2:1641160_s_at:27:71; Interrogation_Position=750; Antisense; AGGCCATTCTGCAGTGGCAGCACTA
>probe:Drosophila_2:1641160_s_at:188:449; Interrogation_Position=795; Antisense; TGATCGAAAACGTTACGGCCGCCCA
>probe:Drosophila_2:1641160_s_at:282:197; Interrogation_Position=914; Antisense; AACGGGTCAGCTTCCACGGCGGATA
>probe:Drosophila_2:1641160_s_at:496:457; Interrogation_Position=935; Antisense; GATAGTCAACAGACGTCTTCTGCCC

Paste this into a BLAST search page for me
TGGAGTTCGTGCAGTGCCTGTCGAATGTCGAACCCCAACTATCTAAACTTTATCTAAACTTCCTTGCACAGCGTGTGCACAGCGTGGATTTTTCAAGGACCAAGGACCAGTCGTTCATCAACTACAAGGAGCCGGACTATGCGAAATACCAAATACCTCATGTACCCAATGTGCCAGTACGAACACTTCCGCCGGGAGATAGATCGTCAACTCGCAGTGCTGCAAGCAAGTTCATAGACGACCAGGCCATAGGCCATTCTGCAGTGGCAGCACTATGATCGAAAACGTTACGGCCGCCCAAACGGGTCAGCTTCCACGGCGGATAGATAGTCAACAGACGTCTTCTGCCC

Full Affymetrix probeset data:

Annotations for 1641160_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime