Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641161_at:

>probe:Drosophila_2:1641161_at:592:659; Interrogation_Position=1906; Antisense; TAACTAGACAGGCAGCCACCTCGAT
>probe:Drosophila_2:1641161_at:330:129; Interrogation_Position=1923; Antisense; ACCTCGATGGCAGCAGGACCAGCAT
>probe:Drosophila_2:1641161_at:265:555; Interrogation_Position=1938; Antisense; GGACCAGCATCGAGCAGCCAACTGT
>probe:Drosophila_2:1641161_at:294:195; Interrogation_Position=1957; Antisense; AACTGTCCGGCAATGTGTTGGCAAC
>probe:Drosophila_2:1641161_at:720:669; Interrogation_Position=2003; Antisense; TACGGCAATGGCAACTTCAGGTCGA
>probe:Drosophila_2:1641161_at:658:305; Interrogation_Position=2055; Antisense; CCGGCTGAGGCTGCTAGTACGACAA
>probe:Drosophila_2:1641161_at:195:397; Interrogation_Position=2075; Antisense; GACAAGTCGCAACGTGAATCAGAAT
>probe:Drosophila_2:1641161_at:26:635; Interrogation_Position=2117; Antisense; TCGAAATGAGCCTGCGAATCAAACT
>probe:Drosophila_2:1641161_at:97:539; Interrogation_Position=2228; Antisense; GGTAAGCCAACCAATCAAACTGCTG
>probe:Drosophila_2:1641161_at:535:177; Interrogation_Position=2256; Antisense; AAACTACTCAGTCTCTGTCCGTTTG
>probe:Drosophila_2:1641161_at:581:691; Interrogation_Position=2277; Antisense; TTTGGGTTTGTTTATTCTGCCTGCC
>probe:Drosophila_2:1641161_at:363:711; Interrogation_Position=2331; Antisense; TTCGAGTTGGGCTCTGATACCCTAA
>probe:Drosophila_2:1641161_at:607:529; Interrogation_Position=2359; Antisense; GGGTATAGCCATTTTGTGGATCACT
>probe:Drosophila_2:1641161_at:229:455; Interrogation_Position=2377; Antisense; GATCACTTTGTTCACACACACTTAG

Paste this into a BLAST search page for me
TAACTAGACAGGCAGCCACCTCGATACCTCGATGGCAGCAGGACCAGCATGGACCAGCATCGAGCAGCCAACTGTAACTGTCCGGCAATGTGTTGGCAACTACGGCAATGGCAACTTCAGGTCGACCGGCTGAGGCTGCTAGTACGACAAGACAAGTCGCAACGTGAATCAGAATTCGAAATGAGCCTGCGAATCAAACTGGTAAGCCAACCAATCAAACTGCTGAAACTACTCAGTCTCTGTCCGTTTGTTTGGGTTTGTTTATTCTGCCTGCCTTCGAGTTGGGCTCTGATACCCTAAGGGTATAGCCATTTTGTGGATCACTGATCACTTTGTTCACACACACTTAG

Full Affymetrix probeset data:

Annotations for 1641161_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime