FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641171_at:

>probe:Drosophila_2:1641171_at:461:215; Interrogation_Position=164; Antisense; AAGTTCCCTTGGCAATCGTCTCGCA
>probe:Drosophila_2:1641171_at:130:533; Interrogation_Position=198; Antisense; GGTGTGCAGCCTGTACAAGCGAGCA
>probe:Drosophila_2:1641171_at:320:421; Interrogation_Position=218; Antisense; GAGCACTGCGCAACTTAGAGTCGTG
>probe:Drosophila_2:1641171_at:484:517; Interrogation_Position=240; Antisense; GTGGTACGACCGACGCAATGTCTAC
>probe:Drosophila_2:1641171_at:155:337; Interrogation_Position=282; Antisense; GCTGCGTGCTCGCTTCGACGAAAAC
>probe:Drosophila_2:1641171_at:72:177; Interrogation_Position=303; Antisense; AAACCGCTCCAAAGATCTGGGCGAG
>probe:Drosophila_2:1641171_at:242:417; Interrogation_Position=358; Antisense; GAGCTTTTCGAGACAAGGCATTTCC
>probe:Drosophila_2:1641171_at:263:87; Interrogation_Position=403; Antisense; AGTGCCGGTGGCTGTGCTTTCGAAC
>probe:Drosophila_2:1641171_at:597:381; Interrogation_Position=424; Antisense; GAACGAGAGGTGATTCCGCCCGACT
>probe:Drosophila_2:1641171_at:678:555; Interrogation_Position=456; Antisense; GGACTACTGGCATCCCCTGGAGAAG
>probe:Drosophila_2:1641171_at:154:547; Interrogation_Position=473; Antisense; TGGAGAAGGCCCAGTACCCCGAGTA
>probe:Drosophila_2:1641171_at:206:555; Interrogation_Position=573; Antisense; GGACCTGGGACACCACTAATCTTAG
>probe:Drosophila_2:1641171_at:441:421; Interrogation_Position=597; Antisense; GAGTACCGTAATCAAATCACATCCA
>probe:Drosophila_2:1641171_at:516:501; Interrogation_Position=695; Antisense; GTCGATCTTCCTTCTGCCAAAATAA

Paste this into a BLAST search page for me
AAGTTCCCTTGGCAATCGTCTCGCAGGTGTGCAGCCTGTACAAGCGAGCAGAGCACTGCGCAACTTAGAGTCGTGGTGGTACGACCGACGCAATGTCTACGCTGCGTGCTCGCTTCGACGAAAACAAACCGCTCCAAAGATCTGGGCGAGGAGCTTTTCGAGACAAGGCATTTCCAGTGCCGGTGGCTGTGCTTTCGAACGAACGAGAGGTGATTCCGCCCGACTGGACTACTGGCATCCCCTGGAGAAGTGGAGAAGGCCCAGTACCCCGAGTAGGACCTGGGACACCACTAATCTTAGGAGTACCGTAATCAAATCACATCCAGTCGATCTTCCTTCTGCCAAAATAA

Full Affymetrix probeset data:

Annotations for 1641171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720