FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641174_at:

>probe:Drosophila_2:1641174_at:404:71; Interrogation_Position=582; Antisense; AGGCTGATGATGTAGGTACCGTGGA
>probe:Drosophila_2:1641174_at:341:131; Interrogation_Position=599; Antisense; ACCGTGGAGTGGGTCGATTCGCTAA
>probe:Drosophila_2:1641174_at:730:301; Interrogation_Position=600; Antisense; CCGTGGAGTGGGTCGATTCGCTAAT
>probe:Drosophila_2:1641174_at:524:433; Interrogation_Position=605; Antisense; GAGTGGGTCGATTCGCTAATGCTGT
>probe:Drosophila_2:1641174_at:344:591; Interrogation_Position=608; Antisense; TGGGTCGATTCGCTAATGCTGTTAC
>probe:Drosophila_2:1641174_at:296:501; Interrogation_Position=611; Antisense; GTCGATTCGCTAATGCTGTTACCCA
>probe:Drosophila_2:1641174_at:470:463; Interrogation_Position=614; Antisense; GATTCGCTAATGCTGTTACCCATTT
>probe:Drosophila_2:1641174_at:278:635; Interrogation_Position=617; Antisense; TCGCTAATGCTGTTACCCATTTCCT
>probe:Drosophila_2:1641174_at:288:233; Interrogation_Position=622; Antisense; AATGCTGTTACCCATTTCCTCTTTA
>probe:Drosophila_2:1641174_at:448:285; Interrogation_Position=626; Antisense; CTGTTACCCATTTCCTCTTTAGCAA
>probe:Drosophila_2:1641174_at:678:705; Interrogation_Position=629; Antisense; TTACCCATTTCCTCTTTAGCAACGT
>probe:Drosophila_2:1641174_at:513:133; Interrogation_Position=631; Antisense; ACCCATTTCCTCTTTAGCAACGTGT
>probe:Drosophila_2:1641174_at:23:309; Interrogation_Position=633; Antisense; CCATTTCCTCTTTAGCAACGTGTGA
>probe:Drosophila_2:1641174_at:408:693; Interrogation_Position=636; Antisense; TTTCCTCTTTAGCAACGTGTGATCA

Paste this into a BLAST search page for me
AGGCTGATGATGTAGGTACCGTGGAACCGTGGAGTGGGTCGATTCGCTAACCGTGGAGTGGGTCGATTCGCTAATGAGTGGGTCGATTCGCTAATGCTGTTGGGTCGATTCGCTAATGCTGTTACGTCGATTCGCTAATGCTGTTACCCAGATTCGCTAATGCTGTTACCCATTTTCGCTAATGCTGTTACCCATTTCCTAATGCTGTTACCCATTTCCTCTTTACTGTTACCCATTTCCTCTTTAGCAATTACCCATTTCCTCTTTAGCAACGTACCCATTTCCTCTTTAGCAACGTGTCCATTTCCTCTTTAGCAACGTGTGATTTCCTCTTTAGCAACGTGTGATCA

Full Affymetrix probeset data:

Annotations for 1641174_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720