Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641176_at:

>probe:Drosophila_2:1641176_at:261:339; Interrogation_Position=2458; Antisense; GCTCACTCTGTTGGATTGCGAATTC
>probe:Drosophila_2:1641176_at:672:461; Interrogation_Position=2490; Antisense; GATTCTTTTTCATCGTGCTGACCGA
>probe:Drosophila_2:1641176_at:263:285; Interrogation_Position=2524; Antisense; CTGGGTGCCCATCATCGTTATGAAG
>probe:Drosophila_2:1641176_at:73:295; Interrogation_Position=2578; Antisense; CGATGACATCTACGCCTGGTTGGTG
>probe:Drosophila_2:1641176_at:225:509; Interrogation_Position=2609; Antisense; GTGCTGCCACTTAACTCGGCGGTTA
>probe:Drosophila_2:1641176_at:40:641; Interrogation_Position=2624; Antisense; TCGGCGGTTAATCCTCTCTTGTACA
>probe:Drosophila_2:1641176_at:187:165; Interrogation_Position=2671; Antisense; AAATCAAATCTTCCTTCGCGGCTGG
>probe:Drosophila_2:1641176_at:661:157; Interrogation_Position=2750; Antisense; ACAACGACGGGCACGGCAACTGGAT
>probe:Drosophila_2:1641176_at:233:547; Interrogation_Position=2788; Antisense; GGATGACTTCACGATCTTTGCCAAA
>probe:Drosophila_2:1641176_at:717:311; Interrogation_Position=2807; Antisense; GCCAAAGCCGCGATGAGATGCCATT
>probe:Drosophila_2:1641176_at:95:13; Interrogation_Position=2829; Antisense; ATTAGGTCCTAACGCTGTCGAACTG
>probe:Drosophila_2:1641176_at:22:523; Interrogation_Position=2864; Antisense; GTGGCGCAGATCGAACTTGTATACC
>probe:Drosophila_2:1641176_at:306:483; Interrogation_Position=2882; Antisense; GTATACCACCAGATTTAGCAGCATT
>probe:Drosophila_2:1641176_at:124:365; Interrogation_Position=2945; Antisense; GAATATCTATCCCTGTCCGTGTAAG

Paste this into a BLAST search page for me
GCTCACTCTGTTGGATTGCGAATTCGATTCTTTTTCATCGTGCTGACCGACTGGGTGCCCATCATCGTTATGAAGCGATGACATCTACGCCTGGTTGGTGGTGCTGCCACTTAACTCGGCGGTTATCGGCGGTTAATCCTCTCTTGTACAAAATCAAATCTTCCTTCGCGGCTGGACAACGACGGGCACGGCAACTGGATGGATGACTTCACGATCTTTGCCAAAGCCAAAGCCGCGATGAGATGCCATTATTAGGTCCTAACGCTGTCGAACTGGTGGCGCAGATCGAACTTGTATACCGTATACCACCAGATTTAGCAGCATTGAATATCTATCCCTGTCCGTGTAAG

Full Affymetrix probeset data:

Annotations for 1641176_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime