Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641177_at:

>probe:Drosophila_2:1641177_at:568:347; Interrogation_Position=1467; Antisense; GCATGAAAAGGCTCCAGTCACATCC
>probe:Drosophila_2:1641177_at:618:693; Interrogation_Position=1583; Antisense; TTTTGCCGGGAGCTCACCGAAGTTC
>probe:Drosophila_2:1641177_at:118:373; Interrogation_Position=1601; Antisense; GAAGTTCCCACGGACGACGGTCTGG
>probe:Drosophila_2:1641177_at:87:409; Interrogation_Position=1616; Antisense; GACGGTCTGGTCCTTCGAAGCAGTC
>probe:Drosophila_2:1641177_at:493:115; Interrogation_Position=1634; Antisense; AGCAGTCGCTTTATGGTGGAATCCA
>probe:Drosophila_2:1641177_at:135:565; Interrogation_Position=1651; Antisense; GGAATCCATCAACCAGCTTATCAAA
>probe:Drosophila_2:1641177_at:183:705; Interrogation_Position=1668; Antisense; TTATCAAACCATTCGGGCAGTGCCG
>probe:Drosophila_2:1641177_at:458:503; Interrogation_Position=1687; Antisense; GTGCCGGCAACTGAAGCTCGAAATG
>probe:Drosophila_2:1641177_at:698:393; Interrogation_Position=1706; Antisense; GAAATGGTTTTACTGGCCCACTTCT
>probe:Drosophila_2:1641177_at:613:309; Interrogation_Position=1723; Antisense; CCACTTCTTGGACTTCGGCGAAGAG
>probe:Drosophila_2:1641177_at:691:373; Interrogation_Position=1742; Antisense; GAAGAGTCCTTCGTCTACGAGTTAA
>probe:Drosophila_2:1641177_at:587:593; Interrogation_Position=1821; Antisense; TGTCGGACGTTCTACTGTTGACCAG
>probe:Drosophila_2:1641177_at:716:31; Interrogation_Position=1850; Antisense; ATCAGCCGGGTCAGTCATTACCTGG
>probe:Drosophila_2:1641177_at:616:639; Interrogation_Position=1890; Antisense; TCGGCGATCCAGACCTGCAAATATT

Paste this into a BLAST search page for me
GCATGAAAAGGCTCCAGTCACATCCTTTTGCCGGGAGCTCACCGAAGTTCGAAGTTCCCACGGACGACGGTCTGGGACGGTCTGGTCCTTCGAAGCAGTCAGCAGTCGCTTTATGGTGGAATCCAGGAATCCATCAACCAGCTTATCAAATTATCAAACCATTCGGGCAGTGCCGGTGCCGGCAACTGAAGCTCGAAATGGAAATGGTTTTACTGGCCCACTTCTCCACTTCTTGGACTTCGGCGAAGAGGAAGAGTCCTTCGTCTACGAGTTAATGTCGGACGTTCTACTGTTGACCAGATCAGCCGGGTCAGTCATTACCTGGTCGGCGATCCAGACCTGCAAATATT

Full Affymetrix probeset data:

Annotations for 1641177_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime