Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641178_s_at:

>probe:Drosophila_2:1641178_s_at:168:71; Interrogation_Position=1018; Antisense; AGGCCGTGCCTCTTGTGCTTTGAGA
>probe:Drosophila_2:1641178_s_at:649:51; Interrogation_Position=1044; Antisense; ATGCATGCTGCAAGGATAGTCTCCA
>probe:Drosophila_2:1641178_s_at:552:75; Interrogation_Position=1056; Antisense; AGGATAGTCTCCAGTTTCCAGTTTC
>probe:Drosophila_2:1641178_s_at:324:265; Interrogation_Position=1074; Antisense; CAGTTTCCACTAAGATATGCCCAAT
>probe:Drosophila_2:1641178_s_at:377:515; Interrogation_Position=606; Antisense; GTGTACCCGAGTGACGAGGACTCTA
>probe:Drosophila_2:1641178_s_at:294:437; Interrogation_Position=621; Antisense; GAGGACTCTAGGACGTTCGCCATCG
>probe:Drosophila_2:1641178_s_at:353:575; Interrogation_Position=746; Antisense; GGCGATGGACATCAGCAACTCGTCG
>probe:Drosophila_2:1641178_s_at:90:449; Interrogation_Position=804; Antisense; GATGCCATGGTTTCAGCGCGCCAAG
>probe:Drosophila_2:1641178_s_at:286:253; Interrogation_Position=825; Antisense; CAAGCTCTGTTTCTCACGGAACAAT
>probe:Drosophila_2:1641178_s_at:406:139; Interrogation_Position=840; Antisense; ACGGAACAATGCAACGCTTCTCTGG
>probe:Drosophila_2:1641178_s_at:728:41; Interrogation_Position=873; Antisense; ATCGAGAGCATCGACTGCGCTTCCT
>probe:Drosophila_2:1641178_s_at:351:37; Interrogation_Position=916; Antisense; ATCTTCTTTTGCTCAAGGCGATCTC
>probe:Drosophila_2:1641178_s_at:161:507; Interrogation_Position=956; Antisense; GTGCCTGCACCAGTGCTTGGGATTA
>probe:Drosophila_2:1641178_s_at:424:721; Interrogation_Position=972; Antisense; TTGGGATTACTGCAACGCCACCAGG

Paste this into a BLAST search page for me
AGGCCGTGCCTCTTGTGCTTTGAGAATGCATGCTGCAAGGATAGTCTCCAAGGATAGTCTCCAGTTTCCAGTTTCCAGTTTCCACTAAGATATGCCCAATGTGTACCCGAGTGACGAGGACTCTAGAGGACTCTAGGACGTTCGCCATCGGGCGATGGACATCAGCAACTCGTCGGATGCCATGGTTTCAGCGCGCCAAGCAAGCTCTGTTTCTCACGGAACAATACGGAACAATGCAACGCTTCTCTGGATCGAGAGCATCGACTGCGCTTCCTATCTTCTTTTGCTCAAGGCGATCTCGTGCCTGCACCAGTGCTTGGGATTATTGGGATTACTGCAACGCCACCAGG

Full Affymetrix probeset data:

Annotations for 1641178_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime