FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641182_at:

>probe:Drosophila_2:1641182_at:130:429; Interrogation_Position=1784; Antisense; GAGATTCTCAAGACCACGTCGCAAA
>probe:Drosophila_2:1641182_at:166:635; Interrogation_Position=1802; Antisense; TCGCAAACACTGACCACCCAGGTGA
>probe:Drosophila_2:1641182_at:115:83; Interrogation_Position=1941; Antisense; AGGGCTGCCTCAAGGAACTGTCGGA
>probe:Drosophila_2:1641182_at:451:381; Interrogation_Position=2013; Antisense; GAACGCAATGGTCGGAGGCACAAAC
>probe:Drosophila_2:1641182_at:168:565; Interrogation_Position=2029; Antisense; GGCACAAACGACACTGGAGGAGCTC
>probe:Drosophila_2:1641182_at:525:75; Interrogation_Position=2046; Antisense; AGGAGCTCGGCATCCAGCTGAGCGT
>probe:Drosophila_2:1641182_at:638:277; Interrogation_Position=2078; Antisense; CTAAAGGTGTCGGAGATGCAGGATC
>probe:Drosophila_2:1641182_at:654:53; Interrogation_Position=2093; Antisense; ATGCAGGATCAGGAGCGTCGCCAGC
>probe:Drosophila_2:1641182_at:245:45; Interrogation_Position=2143; Antisense; ATCGCTGCAAGCCATGCCCGAGGCG
>probe:Drosophila_2:1641182_at:247:317; Interrogation_Position=2219; Antisense; GCCTGCGAGCGGGAGTTCAATCTTA
>probe:Drosophila_2:1641182_at:413:235; Interrogation_Position=2237; Antisense; AATCTTACGCGACGGAAGCACCACT
>probe:Drosophila_2:1641182_at:199:353; Interrogation_Position=2265; Antisense; GCAGCTGCGGCGAGATTTTCTGCAA
>probe:Drosophila_2:1641182_at:222:695; Interrogation_Position=2281; Antisense; TTTCTGCAAGGCCTGTTCGGAGCAC
>probe:Drosophila_2:1641182_at:246:517; Interrogation_Position=2356; Antisense; GTGTGACAATTGCTATGCCGCCAAA

Paste this into a BLAST search page for me
GAGATTCTCAAGACCACGTCGCAAATCGCAAACACTGACCACCCAGGTGAAGGGCTGCCTCAAGGAACTGTCGGAGAACGCAATGGTCGGAGGCACAAACGGCACAAACGACACTGGAGGAGCTCAGGAGCTCGGCATCCAGCTGAGCGTCTAAAGGTGTCGGAGATGCAGGATCATGCAGGATCAGGAGCGTCGCCAGCATCGCTGCAAGCCATGCCCGAGGCGGCCTGCGAGCGGGAGTTCAATCTTAAATCTTACGCGACGGAAGCACCACTGCAGCTGCGGCGAGATTTTCTGCAATTTCTGCAAGGCCTGTTCGGAGCACGTGTGACAATTGCTATGCCGCCAAA

Full Affymetrix probeset data:

Annotations for 1641182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720