FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641185_at:

>probe:Drosophila_2:1641185_at:174:497; Interrogation_Position=148; Antisense; GTCTTCCGCGTGGACAAGGACACCA
>probe:Drosophila_2:1641185_at:567:139; Interrogation_Position=179; Antisense; ACGTGAACATATCCGGTGGACCGTT
>probe:Drosophila_2:1641185_at:490:313; Interrogation_Position=205; Antisense; GCCTACCGCTACCAGTTCGAGGAGA
>probe:Drosophila_2:1641185_at:577:67; Interrogation_Position=242; Antisense; ATGGCACGGAGAATGTTCGCGGATC
>probe:Drosophila_2:1641185_at:416:419; Interrogation_Position=268; Antisense; GAGCACTTCATCCAGGGCTATAGCT
>probe:Drosophila_2:1641185_at:453:691; Interrogation_Position=292; Antisense; TTTCCCGGCGAGATCCAAATCTATG
>probe:Drosophila_2:1641185_at:459:551; Interrogation_Position=327; Antisense; GGAGCTGTACCACAACATGTCCGAG
>probe:Drosophila_2:1641185_at:691:635; Interrogation_Position=364; Antisense; TCGCAGGGAATCGTTGGACTCTCGT
>probe:Drosophila_2:1641185_at:655:465; Interrogation_Position=376; Antisense; GTTGGACTCTCGTTGATGGTGCAAA
>probe:Drosophila_2:1641185_at:350:669; Interrogation_Position=425; Antisense; TACGGATCATCACGAGCACCTTCAA
>probe:Drosophila_2:1641185_at:508:79; Interrogation_Position=465; Antisense; AGGTGAGTGCAAATTTCCAGCCCGC
>probe:Drosophila_2:1641185_at:16:141; Interrogation_Position=47; Antisense; ACGTGGTGCCCGACAAGTTGCTCTT
>probe:Drosophila_2:1641185_at:246:95; Interrogation_Position=62; Antisense; AGTTGCTCTTCGATCCATATTTGCG
>probe:Drosophila_2:1641185_at:363:611; Interrogation_Position=99; Antisense; TGACAAGCACAAGGTTTCCGGCACT

Paste this into a BLAST search page for me
GTCTTCCGCGTGGACAAGGACACCAACGTGAACATATCCGGTGGACCGTTGCCTACCGCTACCAGTTCGAGGAGAATGGCACGGAGAATGTTCGCGGATCGAGCACTTCATCCAGGGCTATAGCTTTTCCCGGCGAGATCCAAATCTATGGGAGCTGTACCACAACATGTCCGAGTCGCAGGGAATCGTTGGACTCTCGTGTTGGACTCTCGTTGATGGTGCAAATACGGATCATCACGAGCACCTTCAAAGGTGAGTGCAAATTTCCAGCCCGCACGTGGTGCCCGACAAGTTGCTCTTAGTTGCTCTTCGATCCATATTTGCGTGACAAGCACAAGGTTTCCGGCACT

Full Affymetrix probeset data:

Annotations for 1641185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720