FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641186_at:

>probe:Drosophila_2:1641186_at:702:257; Interrogation_Position=142; Antisense; CAGCCCGGCGGGATAGTTAGCAACC
>probe:Drosophila_2:1641186_at:582:169; Interrogation_Position=182; Antisense; AAAGTCTGACAACATTGGCGCGGGT
>probe:Drosophila_2:1641186_at:302:195; Interrogation_Position=344; Antisense; AACTGAATGCCACACAGCCGTTTGG
>probe:Drosophila_2:1641186_at:188:583; Interrogation_Position=366; Antisense; TGGCGGCTCGGGTCTGAACTTCAAC
>probe:Drosophila_2:1641186_at:269:385; Interrogation_Position=381; Antisense; GAACTTCAACGAAAGCGGCGCAGGA
>probe:Drosophila_2:1641186_at:481:331; Interrogation_Position=395; Antisense; GCGGCGCAGGATTAAGTGACCATCA
>probe:Drosophila_2:1641186_at:218:33; Interrogation_Position=425; Antisense; ATCAACAACACAATCCCGACGAGGA
>probe:Drosophila_2:1641186_at:438:3; Interrogation_Position=449; Antisense; ATTGGCTGGACAACATCGTTTGGGT
>probe:Drosophila_2:1641186_at:201:269; Interrogation_Position=462; Antisense; CATCGTTTGGGTGTTCAAGGCCTTT
>probe:Drosophila_2:1641186_at:280:227; Interrogation_Position=478; Antisense; AAGGCCTTTGTCATGCTGCTCATCA
>probe:Drosophila_2:1641186_at:648:271; Interrogation_Position=513; Antisense; CATCTGCGGCAATCTGCTTGTTATT
>probe:Drosophila_2:1641186_at:469:51; Interrogation_Position=626; Antisense; ATGCTGACTCCGTGTCCTTTATTTA
>probe:Drosophila_2:1641186_at:180:505; Interrogation_Position=639; Antisense; GTCCTTTATTTACTCGCCTCATAAT
>probe:Drosophila_2:1641186_at:577:201; Interrogation_Position=69; Antisense; AACCAGTGCCGCCAGGATTAGAAAA

Paste this into a BLAST search page for me
CAGCCCGGCGGGATAGTTAGCAACCAAAGTCTGACAACATTGGCGCGGGTAACTGAATGCCACACAGCCGTTTGGTGGCGGCTCGGGTCTGAACTTCAACGAACTTCAACGAAAGCGGCGCAGGAGCGGCGCAGGATTAAGTGACCATCAATCAACAACACAATCCCGACGAGGAATTGGCTGGACAACATCGTTTGGGTCATCGTTTGGGTGTTCAAGGCCTTTAAGGCCTTTGTCATGCTGCTCATCACATCTGCGGCAATCTGCTTGTTATTATGCTGACTCCGTGTCCTTTATTTAGTCCTTTATTTACTCGCCTCATAATAACCAGTGCCGCCAGGATTAGAAAA

Full Affymetrix probeset data:

Annotations for 1641186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720