FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641187_at:

>probe:Drosophila_2:1641187_at:169:353; Interrogation_Position=1874; Antisense; GCAGCGCCGCACTCGAAGATTGTGA
>probe:Drosophila_2:1641187_at:658:373; Interrogation_Position=1897; Antisense; GAAGAACATTTCCACGGACTACGCA
>probe:Drosophila_2:1641187_at:596:557; Interrogation_Position=1912; Antisense; GGACTACGCAGTGGACATCACCCTG
>probe:Drosophila_2:1641187_at:589:627; Interrogation_Position=1973; Antisense; TCCACGGTGCGGATGACGGGCTATA
>probe:Drosophila_2:1641187_at:475:23; Interrogation_Position=1995; Antisense; ATACGACCGTACTAACGGGCACCAT
>probe:Drosophila_2:1641187_at:448:567; Interrogation_Position=2012; Antisense; GGCACCATTAGTCGTCTGAATCTGT
>probe:Drosophila_2:1641187_at:641:379; Interrogation_Position=2040; Antisense; GAAGCCAGAGCTACTGTCTCAACGA
>probe:Drosophila_2:1641187_at:80:137; Interrogation_Position=2061; Antisense; ACGATCCGGCGCTAAAAATGTTCTG
>probe:Drosophila_2:1641187_at:104:169; Interrogation_Position=2076; Antisense; AAATGTTCTGCTATTGCCACAGATA
>probe:Drosophila_2:1641187_at:440:199; Interrogation_Position=2167; Antisense; AACCCATTAACGTAGCCTTAGCCAT
>probe:Drosophila_2:1641187_at:55:681; Interrogation_Position=2241; Antisense; TATCCAATTTTAGCCTTTGCCGTAA
>probe:Drosophila_2:1641187_at:35:373; Interrogation_Position=2263; Antisense; TAAGGAGTTCCCAGTCTTAGGCACC
>probe:Drosophila_2:1641187_at:712:71; Interrogation_Position=2281; Antisense; AGGCACCTATGTAGTCACGGTAGTT
>probe:Drosophila_2:1641187_at:480:417; Interrogation_Position=2306; Antisense; GAGCGGAATTTGTTTATTTCCCACT

Paste this into a BLAST search page for me
GCAGCGCCGCACTCGAAGATTGTGAGAAGAACATTTCCACGGACTACGCAGGACTACGCAGTGGACATCACCCTGTCCACGGTGCGGATGACGGGCTATAATACGACCGTACTAACGGGCACCATGGCACCATTAGTCGTCTGAATCTGTGAAGCCAGAGCTACTGTCTCAACGAACGATCCGGCGCTAAAAATGTTCTGAAATGTTCTGCTATTGCCACAGATAAACCCATTAACGTAGCCTTAGCCATTATCCAATTTTAGCCTTTGCCGTAATAAGGAGTTCCCAGTCTTAGGCACCAGGCACCTATGTAGTCACGGTAGTTGAGCGGAATTTGTTTATTTCCCACT

Full Affymetrix probeset data:

Annotations for 1641187_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720