FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641190_at:

>probe:Drosophila_2:1641190_at:75:137; Interrogation_Position=230; Antisense; ACGAATGGGTACTCACTGCGGCTCA
>probe:Drosophila_2:1641190_at:474:413; Interrogation_Position=266; Antisense; GAGCCAGTTACGTGACCATCAGCTA
>probe:Drosophila_2:1641190_at:551:117; Interrogation_Position=286; Antisense; AGCTATGGAGCTGTGTGGCGCCAAC
>probe:Drosophila_2:1641190_at:119:457; Interrogation_Position=331; Antisense; GATACCGGTAACTTGCACAACGACA
>probe:Drosophila_2:1641190_at:115:419; Interrogation_Position=409; Antisense; GAGCTGCCCAGATACGACGATCGTT
>probe:Drosophila_2:1641190_at:282:185; Interrogation_Position=436; Antisense; AACAACTTCTATGGCTGGTGGGCCC
>probe:Drosophila_2:1641190_at:597:571; Interrogation_Position=475; Antisense; GGCTCTTCCTCTGATAGCAGCGGGA
>probe:Drosophila_2:1641190_at:264:611; Interrogation_Position=500; Antisense; TGACCGACTACCTCAACTGCGTGGA
>probe:Drosophila_2:1641190_at:463:559; Interrogation_Position=537; Antisense; GGACAACAGTGTCTGCCTGGACTAC
>probe:Drosophila_2:1641190_at:446:557; Interrogation_Position=555; Antisense; GGACTACTACGGCAGCCACTATATC
>probe:Drosophila_2:1641190_at:226:359; Interrogation_Position=665; Antisense; GCAATCGTCAGGTGGGCATTGTCTC
>probe:Drosophila_2:1641190_at:385:155; Interrogation_Position=719; Antisense; ACAGCCCCAAAGGATTGACCCGAGT
>probe:Drosophila_2:1641190_at:128:433; Interrogation_Position=740; Antisense; GAGTGACCGGTTACTTGGACTGGAT
>probe:Drosophila_2:1641190_at:3:297; Interrogation_Position=768; Antisense; CGACCATACTGGCATTTCTTACTAA

Paste this into a BLAST search page for me
ACGAATGGGTACTCACTGCGGCTCAGAGCCAGTTACGTGACCATCAGCTAAGCTATGGAGCTGTGTGGCGCCAACGATACCGGTAACTTGCACAACGACAGAGCTGCCCAGATACGACGATCGTTAACAACTTCTATGGCTGGTGGGCCCGGCTCTTCCTCTGATAGCAGCGGGATGACCGACTACCTCAACTGCGTGGAGGACAACAGTGTCTGCCTGGACTACGGACTACTACGGCAGCCACTATATCGCAATCGTCAGGTGGGCATTGTCTCACAGCCCCAAAGGATTGACCCGAGTGAGTGACCGGTTACTTGGACTGGATCGACCATACTGGCATTTCTTACTAA

Full Affymetrix probeset data:

Annotations for 1641190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720