Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641192_at:

>probe:Drosophila_2:1641192_at:491:537; Interrogation_Position=1659; Antisense; GGTATGGCAGTCTGGGCACCTTGCT
>probe:Drosophila_2:1641192_at:363:351; Interrogation_Position=1690; Antisense; GCAGTTGGCACACAGCTTGGAAGAT
>probe:Drosophila_2:1641192_at:315:547; Interrogation_Position=1726; Antisense; GGATGCCAAGTCCTTTGCTGAGTAC
>probe:Drosophila_2:1641192_at:395:487; Interrogation_Position=1780; Antisense; GTACGGTAGACTGCGGCTCAATGGA
>probe:Drosophila_2:1641192_at:384:229; Interrogation_Position=1799; Antisense; AATGGACATTACTTGCCGGAGAGCG
>probe:Drosophila_2:1641192_at:168:673; Interrogation_Position=1842; Antisense; TAGCCGACAATCTGGCCATTCAGGT
>probe:Drosophila_2:1641192_at:363:63; Interrogation_Position=1886; Antisense; AGGCTTCTGGCGGAACTGGACCCAT
>probe:Drosophila_2:1641192_at:660:375; Interrogation_Position=1956; Antisense; GAAGACTGTTCTTCCTCAGCTTTGC
>probe:Drosophila_2:1641192_at:703:647; Interrogation_Position=1971; Antisense; TCAGCTTTGCCCAGTTATGGTGCAA
>probe:Drosophila_2:1641192_at:222:209; Interrogation_Position=2021; Antisense; AAGCAATCCCTGTTTTTGGGCACTC
>probe:Drosophila_2:1641192_at:175:509; Interrogation_Position=2060; Antisense; GTGCTGGGAGCACTATCGAACTTTA
>probe:Drosophila_2:1641192_at:552:33; Interrogation_Position=2074; Antisense; ATCGAACTTTAGAGCCTTTGGACGG
>probe:Drosophila_2:1641192_at:716:419; Interrogation_Position=2097; Antisense; GGGACTTTAACTGCGGGACCGCTAG
>probe:Drosophila_2:1641192_at:370:109; Interrogation_Position=2139; Antisense; AGAAGTGTCAGCTCTTCGCCGTTAA

Paste this into a BLAST search page for me
GGTATGGCAGTCTGGGCACCTTGCTGCAGTTGGCACACAGCTTGGAAGATGGATGCCAAGTCCTTTGCTGAGTACGTACGGTAGACTGCGGCTCAATGGAAATGGACATTACTTGCCGGAGAGCGTAGCCGACAATCTGGCCATTCAGGTAGGCTTCTGGCGGAACTGGACCCATGAAGACTGTTCTTCCTCAGCTTTGCTCAGCTTTGCCCAGTTATGGTGCAAAAGCAATCCCTGTTTTTGGGCACTCGTGCTGGGAGCACTATCGAACTTTAATCGAACTTTAGAGCCTTTGGACGGGGGACTTTAACTGCGGGACCGCTAGAGAAGTGTCAGCTCTTCGCCGTTAA

Full Affymetrix probeset data:

Annotations for 1641192_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime