FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641195_at:

>probe:Drosophila_2:1641195_at:124:273; Interrogation_Position=436; Antisense; CATTAACACCGAGGTTCTGGGCGTT
>probe:Drosophila_2:1641195_at:136:131; Interrogation_Position=488; Antisense; ACCTGGTGCAATGTCGACCGCAAGA
>probe:Drosophila_2:1641195_at:343:433; Interrogation_Position=519; Antisense; GAGTGGGCCAGCTGAAGTACCCGCT
>probe:Drosophila_2:1641195_at:283:337; Interrogation_Position=541; Antisense; GCTCCTCTCCGATTTGACCAAGAAG
>probe:Drosophila_2:1641195_at:282:211; Interrogation_Position=560; Antisense; AAGAAGATCTCTGCCGACTACGATG
>probe:Drosophila_2:1641195_at:580:303; Interrogation_Position=573; Antisense; CCGACTACGATGTGTTGCTGGACAA
>probe:Drosophila_2:1641195_at:521:283; Interrogation_Position=647; Antisense; CTGCGCCAGTACTCCATTAATGATT
>probe:Drosophila_2:1641195_at:70:297; Interrogation_Position=691; Antisense; CGACGAGGTTCTGCGCCTGATCAAA
>probe:Drosophila_2:1641195_at:184:453; Interrogation_Position=709; Antisense; GATCAAAGCCTTCCAGTTCGTCGAG
>probe:Drosophila_2:1641195_at:398:367; Interrogation_Position=775; Antisense; GAATCCGGCTACCATTAAGCCCGAT
>probe:Drosophila_2:1641195_at:498:373; Interrogation_Position=814; Antisense; GAAGTACTTCAGCAAGCACGGCTAG
>probe:Drosophila_2:1641195_at:533:355; Interrogation_Position=829; Antisense; GCACGGCTAGAGGATCATCTGATTA
>probe:Drosophila_2:1641195_at:157:663; Interrogation_Position=859; Antisense; TAAACACCCTAAACATTCACTACAC
>probe:Drosophila_2:1641195_at:289:181; Interrogation_Position=946; Antisense; AAAACCCTAGGCATCGCACTAACTA

Paste this into a BLAST search page for me
CATTAACACCGAGGTTCTGGGCGTTACCTGGTGCAATGTCGACCGCAAGAGAGTGGGCCAGCTGAAGTACCCGCTGCTCCTCTCCGATTTGACCAAGAAGAAGAAGATCTCTGCCGACTACGATGCCGACTACGATGTGTTGCTGGACAACTGCGCCAGTACTCCATTAATGATTCGACGAGGTTCTGCGCCTGATCAAAGATCAAAGCCTTCCAGTTCGTCGAGGAATCCGGCTACCATTAAGCCCGATGAAGTACTTCAGCAAGCACGGCTAGGCACGGCTAGAGGATCATCTGATTATAAACACCCTAAACATTCACTACACAAAACCCTAGGCATCGCACTAACTA

Full Affymetrix probeset data:

Annotations for 1641195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720