Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641196_at:

>probe:Drosophila_2:1641196_at:551:161; Interrogation_Position=1010; Antisense; AAACTTCAGTTTGCACTAGGGCTTG
>probe:Drosophila_2:1641196_at:115:277; Interrogation_Position=1025; Antisense; CTAGGGCTTGAAATATGATCGTGCG
>probe:Drosophila_2:1641196_at:60:59; Interrogation_Position=1039; Antisense; ATGATCGTGCGGATATCGCTGTGTA
>probe:Drosophila_2:1641196_at:715:331; Interrogation_Position=1056; Antisense; GCTGTGTAGGGCAATTGGGTTTCAA
>probe:Drosophila_2:1641196_at:408:561; Interrogation_Position=635; Antisense; GGAAACAGCGTGAAACACTATTCTT
>probe:Drosophila_2:1641196_at:603:171; Interrogation_Position=672; Antisense; AAAGCAATTCGAGATCCGTAGATTA
>probe:Drosophila_2:1641196_at:88:167; Interrogation_Position=704; Antisense; AAATGGCCAGAATGAAGGACTTCAA
>probe:Drosophila_2:1641196_at:393:645; Interrogation_Position=725; Antisense; TCAAGGTCTGGGAAGCAACTATGTT
>probe:Drosophila_2:1641196_at:238:201; Interrogation_Position=782; Antisense; AACCACATCTGTTCTTTAGGCCAAA
>probe:Drosophila_2:1641196_at:200:221; Interrogation_Position=806; Antisense; AAGTGCATTCGCCTAGAACGGAAAA
>probe:Drosophila_2:1641196_at:650:593; Interrogation_Position=861; Antisense; TGTGTTTATAGAATTCCGGCGCGAA
>probe:Drosophila_2:1641196_at:400:375; Interrogation_Position=937; Antisense; GAAGACGATACTGCAATAGACGAAA
>probe:Drosophila_2:1641196_at:28:479; Interrogation_Position=962; Antisense; GTTTCTATGAAGAGCCTGACGACGA
>probe:Drosophila_2:1641196_at:52:317; Interrogation_Position=975; Antisense; GCCTGACGACGAAGAGCAGTTGGAT

Paste this into a BLAST search page for me
AAACTTCAGTTTGCACTAGGGCTTGCTAGGGCTTGAAATATGATCGTGCGATGATCGTGCGGATATCGCTGTGTAGCTGTGTAGGGCAATTGGGTTTCAAGGAAACAGCGTGAAACACTATTCTTAAAGCAATTCGAGATCCGTAGATTAAAATGGCCAGAATGAAGGACTTCAATCAAGGTCTGGGAAGCAACTATGTTAACCACATCTGTTCTTTAGGCCAAAAAGTGCATTCGCCTAGAACGGAAAATGTGTTTATAGAATTCCGGCGCGAAGAAGACGATACTGCAATAGACGAAAGTTTCTATGAAGAGCCTGACGACGAGCCTGACGACGAAGAGCAGTTGGAT

Full Affymetrix probeset data:

Annotations for 1641196_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime