FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641198_at:

>probe:Drosophila_2:1641198_at:32:199; Interrogation_Position=1118; Antisense; AACGTGATAACGTCGAACGCGAGAA
>probe:Drosophila_2:1641198_at:716:605; Interrogation_Position=1152; Antisense; TGATCGCATGCGCAACATGACCGAA
>probe:Drosophila_2:1641198_at:312:151; Interrogation_Position=1166; Antisense; ACATGACCGAAGAGGAGCGACGCCA
>probe:Drosophila_2:1641198_at:35:119; Interrogation_Position=1193; Antisense; AGCTGCGCCAGAACCCCAAGGTGGT
>probe:Drosophila_2:1641198_at:602:221; Interrogation_Position=1234; Antisense; AAGGGCAAGTACAAGTTCCTGCAGA
>probe:Drosophila_2:1641198_at:665:109; Interrogation_Position=1256; Antisense; AGAAGTACTATCATCGTGGTGCCTT
>probe:Drosophila_2:1641198_at:111:637; Interrogation_Position=1269; Antisense; TCGTGGTGCCTTCTACCTGGATGAG
>probe:Drosophila_2:1641198_at:693:75; Interrogation_Position=1292; Antisense; AGGAGAACGACGTCCTCAAGCGCGA
>probe:Drosophila_2:1641198_at:102:545; Interrogation_Position=1338; Antisense; GGATCACTTCGATAAGACCATTCTG
>probe:Drosophila_2:1641198_at:133:619; Interrogation_Position=1373; Antisense; TGCAGGTGAAGAACTTCGGCCGCTG
>probe:Drosophila_2:1641198_at:11:579; Interrogation_Position=1399; Antisense; GGCCGCACCAAGTACACTCATTTAG
>probe:Drosophila_2:1641198_at:169:147; Interrogation_Position=1414; Antisense; ACTCATTTAGTGGACCAGGACACCA
>probe:Drosophila_2:1641198_at:8:323; Interrogation_Position=1530; Antisense; GCCCACCGGCTCGAAGCGAAAAAAG
>probe:Drosophila_2:1641198_at:96:509; Interrogation_Position=1623; Antisense; GTGCGGCCACAGTTATGATGGAACC

Paste this into a BLAST search page for me
AACGTGATAACGTCGAACGCGAGAATGATCGCATGCGCAACATGACCGAAACATGACCGAAGAGGAGCGACGCCAAGCTGCGCCAGAACCCCAAGGTGGTAAGGGCAAGTACAAGTTCCTGCAGAAGAAGTACTATCATCGTGGTGCCTTTCGTGGTGCCTTCTACCTGGATGAGAGGAGAACGACGTCCTCAAGCGCGAGGATCACTTCGATAAGACCATTCTGTGCAGGTGAAGAACTTCGGCCGCTGGGCCGCACCAAGTACACTCATTTAGACTCATTTAGTGGACCAGGACACCAGCCCACCGGCTCGAAGCGAAAAAAGGTGCGGCCACAGTTATGATGGAACC

Full Affymetrix probeset data:

Annotations for 1641198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720