Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641200_at:

>probe:Drosophila_2:1641200_at:27:599; Interrogation_Position=270; Antisense; TGTCAGTGCGTCTGTCCTTTTAATC
>probe:Drosophila_2:1641200_at:435:701; Interrogation_Position=287; Antisense; TTTTAATCGCCTTGTCGCTGCTCAG
>probe:Drosophila_2:1641200_at:726:621; Interrogation_Position=336; Antisense; TGCGGCGCAGCGTGACGAGAACTAT
>probe:Drosophila_2:1641200_at:99:317; Interrogation_Position=366; Antisense; GCCGGGCATCCTGAAAATGGCCAAG
>probe:Drosophila_2:1641200_at:23:213; Interrogation_Position=415; Antisense; AAGACGGGCGTAACCGAGGCTGCCA
>probe:Drosophila_2:1641200_at:596:667; Interrogation_Position=490; Antisense; TACATGAACTGCTTCTTCCACGAGA
>probe:Drosophila_2:1641200_at:54:557; Interrogation_Position=537; Antisense; GGACGTGCATCTGGAGAAGCTCTTC
>probe:Drosophila_2:1641200_at:487:551; Interrogation_Position=597; Antisense; GGAGATGTCCAAGGGCTGCGTCCAT
>probe:Drosophila_2:1641200_at:281:83; Interrogation_Position=626; Antisense; AGGGCGATACGCTGTGCCACAAGGC
>probe:Drosophila_2:1641200_at:242:559; Interrogation_Position=671; Antisense; GGAAAAAGGCCGATCCCAAGCACTA
>probe:Drosophila_2:1641200_at:552:207; Interrogation_Position=688; Antisense; AAGCACTACTTCTTGCCGTGAACAC
>probe:Drosophila_2:1641200_at:75:95; Interrogation_Position=732; Antisense; AGTTCCAGTTCCATGGTCCGTGGAC
>probe:Drosophila_2:1641200_at:609:411; Interrogation_Position=768; Antisense; GACCCCGCTCTATTTATGTGGTAGT
>probe:Drosophila_2:1641200_at:350:177; Interrogation_Position=829; Antisense; AAACGTAGGCGAGTTGTGCATGCAA

Paste this into a BLAST search page for me
TGTCAGTGCGTCTGTCCTTTTAATCTTTTAATCGCCTTGTCGCTGCTCAGTGCGGCGCAGCGTGACGAGAACTATGCCGGGCATCCTGAAAATGGCCAAGAAGACGGGCGTAACCGAGGCTGCCATACATGAACTGCTTCTTCCACGAGAGGACGTGCATCTGGAGAAGCTCTTCGGAGATGTCCAAGGGCTGCGTCCATAGGGCGATACGCTGTGCCACAAGGCGGAAAAAGGCCGATCCCAAGCACTAAAGCACTACTTCTTGCCGTGAACACAGTTCCAGTTCCATGGTCCGTGGACGACCCCGCTCTATTTATGTGGTAGTAAACGTAGGCGAGTTGTGCATGCAA

Full Affymetrix probeset data:

Annotations for 1641200_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime