FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641201_at:

>probe:Drosophila_2:1641201_at:22:657; Interrogation_Position=120; Antisense; TAATGGCATGACTTTTCGCACCGCT
>probe:Drosophila_2:1641201_at:157:381; Interrogation_Position=146; Antisense; GAACCTTGGATCATTTCGATGCTTT
>probe:Drosophila_2:1641201_at:313:611; Interrogation_Position=216; Antisense; TGACGAATTTGATAGCCTGGAGCAT
>probe:Drosophila_2:1641201_at:448:457; Interrogation_Position=242; Antisense; GATACCACATCGTTCATCCAATAGG
>probe:Drosophila_2:1641201_at:157:97; Interrogation_Position=270; Antisense; AGAAATAGCCCTCAAGCGGAACCCG
>probe:Drosophila_2:1641201_at:198:379; Interrogation_Position=288; Antisense; GAACCCGCTCCCTGAGGAGAAGTAT
>probe:Drosophila_2:1641201_at:91:101; Interrogation_Position=30; Antisense; AGAGGACCAGATTACCTGGCCGGAT
>probe:Drosophila_2:1641201_at:362:711; Interrogation_Position=325; Antisense; TTCAAGTTCGGCTGCTGTCACAACT
>probe:Drosophila_2:1641201_at:609:61; Interrogation_Position=363; Antisense; ATGTGCTGGCGTTTGTCCGGAGACA
>probe:Drosophila_2:1641201_at:77:165; Interrogation_Position=403; Antisense; AAATACTGTGTACCGCTTTGCGGAC
>probe:Drosophila_2:1641201_at:161:299; Interrogation_Position=428; Antisense; CGCCTTGTCGCTGTAAGCGTGGTTA
>probe:Drosophila_2:1641201_at:447:53; Interrogation_Position=53; Antisense; ATGACATTGCCGAGCCAACCTTGGA
>probe:Drosophila_2:1641201_at:253:589; Interrogation_Position=74; Antisense; TGGAGTCTGAGTTGACCTGGCCCAA
>probe:Drosophila_2:1641201_at:72:577; Interrogation_Position=92; Antisense; GGCCCAATGAACTTCCGGTAACAGT

Paste this into a BLAST search page for me
TAATGGCATGACTTTTCGCACCGCTGAACCTTGGATCATTTCGATGCTTTTGACGAATTTGATAGCCTGGAGCATGATACCACATCGTTCATCCAATAGGAGAAATAGCCCTCAAGCGGAACCCGGAACCCGCTCCCTGAGGAGAAGTATAGAGGACCAGATTACCTGGCCGGATTTCAAGTTCGGCTGCTGTCACAACTATGTGCTGGCGTTTGTCCGGAGACAAAATACTGTGTACCGCTTTGCGGACCGCCTTGTCGCTGTAAGCGTGGTTAATGACATTGCCGAGCCAACCTTGGATGGAGTCTGAGTTGACCTGGCCCAAGGCCCAATGAACTTCCGGTAACAGT

Full Affymetrix probeset data:

Annotations for 1641201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720