FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641203_at:

>probe:Drosophila_2:1641203_at:414:49; Interrogation_Position=119; Antisense; ATGCCCAGGCATTTGGAGTTGCTAC
>probe:Drosophila_2:1641203_at:398:427; Interrogation_Position=134; Antisense; GAGTTGCTACTGAGTCTCTGATCCT
>probe:Drosophila_2:1641203_at:5:609; Interrogation_Position=144; Antisense; TGAGTCTCTGATCCTGGCCTTCGAT
>probe:Drosophila_2:1641203_at:395:449; Interrogation_Position=153; Antisense; GATCCTGGCCTTCGATGGTGAGAAA
>probe:Drosophila_2:1641203_at:305:549; Interrogation_Position=186; Antisense; GGAGGACACATTTGACTCCTTGGCC
>probe:Drosophila_2:1641203_at:264:399; Interrogation_Position=190; Antisense; GACACATTTGACTCCTTGGCCATGG
>probe:Drosophila_2:1641203_at:290:579; Interrogation_Position=207; Antisense; GGCCATGGAGGATAATGACATCGTC
>probe:Drosophila_2:1641203_at:18:401; Interrogation_Position=223; Antisense; GACATCGTCGATGTTGTAGAAGAAT
>probe:Drosophila_2:1641203_at:600:181; Interrogation_Position=28; Antisense; AAAACCATTTGGCTTCTATCCTCAA
>probe:Drosophila_2:1641203_at:573:343; Interrogation_Position=39; Antisense; GCTTCTATCCTCAAATCTACCTAAA
>probe:Drosophila_2:1641203_at:724:35; Interrogation_Position=53; Antisense; ATCTACCTAAACTGCGGTGCCATGT
>probe:Drosophila_2:1641203_at:440:143; Interrogation_Position=63; Antisense; ACTGCGGTGCCATGTGAGAACGGAT
>probe:Drosophila_2:1641203_at:45:421; Interrogation_Position=78; Antisense; GAGAACGGATCAACCTTTGGCCGCA
>probe:Drosophila_2:1641203_at:463:691; Interrogation_Position=93; Antisense; TTTGGCCGCACTTCTTAGGCAAAAA

Paste this into a BLAST search page for me
ATGCCCAGGCATTTGGAGTTGCTACGAGTTGCTACTGAGTCTCTGATCCTTGAGTCTCTGATCCTGGCCTTCGATGATCCTGGCCTTCGATGGTGAGAAAGGAGGACACATTTGACTCCTTGGCCGACACATTTGACTCCTTGGCCATGGGGCCATGGAGGATAATGACATCGTCGACATCGTCGATGTTGTAGAAGAATAAAACCATTTGGCTTCTATCCTCAAGCTTCTATCCTCAAATCTACCTAAAATCTACCTAAACTGCGGTGCCATGTACTGCGGTGCCATGTGAGAACGGATGAGAACGGATCAACCTTTGGCCGCATTTGGCCGCACTTCTTAGGCAAAAA

Full Affymetrix probeset data:

Annotations for 1641203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720