FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641204_at:

>probe:Drosophila_2:1641204_at:684:237; Interrogation_Position=1138; Antisense; AATAACTTTACTTGTGGCGGCGGCG
>probe:Drosophila_2:1641204_at:221:621; Interrogation_Position=1190; Antisense; TGCTGCTTATGAACGGCACCCGGAA
>probe:Drosophila_2:1641204_at:368:55; Interrogation_Position=1223; Antisense; ATGAAGATGGGTGCTGCTCTCCGGC
>probe:Drosophila_2:1641204_at:43:695; Interrogation_Position=1280; Antisense; TTTGCGTTCAAGAGTCCGATCTGAC
>probe:Drosophila_2:1641204_at:331:441; Interrogation_Position=1312; Antisense; GATGAGCGAGCTGTGTTCCCGGAAA
>probe:Drosophila_2:1641204_at:674:719; Interrogation_Position=1327; Antisense; TTCCCGGAAATCGACAAGCCCAATT
>probe:Drosophila_2:1641204_at:719:427; Interrogation_Position=1355; Antisense; GAGTTTGTCGATCCTCGAACGAGAC
>probe:Drosophila_2:1641204_at:389:87; Interrogation_Position=1402; Antisense; AGTCCTTTGAATGATTGCAGCCCCA
>probe:Drosophila_2:1641204_at:318:655; Interrogation_Position=1526; Antisense; TAATCAACTGGCTTGAGTCCCCGGC
>probe:Drosophila_2:1641204_at:5:577; Interrogation_Position=1548; Antisense; GGCCACGAGTAACTTCACCAAGGTT
>probe:Drosophila_2:1641204_at:24:563; Interrogation_Position=1575; Antisense; GGAACTGCAGAGATCTCGCATCAAG
>probe:Drosophila_2:1641204_at:224:353; Interrogation_Position=1635; Antisense; GCAGCAGACAATCCAGCACAAGGTT
>probe:Drosophila_2:1641204_at:459:251; Interrogation_Position=1653; Antisense; CAAGGTTGCGGAGCTGCAGTGCACA
>probe:Drosophila_2:1641204_at:634:349; Interrogation_Position=1668; Antisense; GCAGTGCACAGATATACCGGATCCT

Paste this into a BLAST search page for me
AATAACTTTACTTGTGGCGGCGGCGTGCTGCTTATGAACGGCACCCGGAAATGAAGATGGGTGCTGCTCTCCGGCTTTGCGTTCAAGAGTCCGATCTGACGATGAGCGAGCTGTGTTCCCGGAAATTCCCGGAAATCGACAAGCCCAATTGAGTTTGTCGATCCTCGAACGAGACAGTCCTTTGAATGATTGCAGCCCCATAATCAACTGGCTTGAGTCCCCGGCGGCCACGAGTAACTTCACCAAGGTTGGAACTGCAGAGATCTCGCATCAAGGCAGCAGACAATCCAGCACAAGGTTCAAGGTTGCGGAGCTGCAGTGCACAGCAGTGCACAGATATACCGGATCCT

Full Affymetrix probeset data:

Annotations for 1641204_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720