Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641208_s_at:

>probe:Drosophila_2:1641208_s_at:48:481; Interrogation_Position=1067; Antisense; GTTTGCAGTCGAGAGGTCTTAACCA
>probe:Drosophila_2:1641208_s_at:564:611; Interrogation_Position=1172; Antisense; TGAACCATGCAACCCTAAAGGCTTT
>probe:Drosophila_2:1641208_s_at:267:233; Interrogation_Position=1220; Antisense; AATCTGTTTTTCTCCATCATTAGCT
>probe:Drosophila_2:1641208_s_at:182:245; Interrogation_Position=1325; Antisense; AATTATTCCACAGACCATTGCTGAA
>probe:Drosophila_2:1641208_s_at:268:477; Interrogation_Position=1377; Antisense; GTAGTGAATAACTCGCACCTTTATA
>probe:Drosophila_2:1641208_s_at:143:661; Interrogation_Position=816; Antisense; TAAAAGTTAATGTGTGTGGCCGGCG
>probe:Drosophila_2:1641208_s_at:239:305; Interrogation_Position=835; Antisense; CCGGCGCGTGAAGAATGGCAATTAC
>probe:Drosophila_2:1641208_s_at:470:637; Interrogation_Position=863; Antisense; TCGATGATCGCCGTGAACCAGCTGG
>probe:Drosophila_2:1641208_s_at:321:613; Interrogation_Position=876; Antisense; TGAACCAGCTGGCTCATTTAGCCTC
>probe:Drosophila_2:1641208_s_at:281:15; Interrogation_Position=891; Antisense; ATTTAGCCTCCTTAATTATGCCACG
>probe:Drosophila_2:1641208_s_at:47:705; Interrogation_Position=906; Antisense; TTATGCCACGATTTCGCTCATCCAA
>probe:Drosophila_2:1641208_s_at:614:587; Interrogation_Position=950; Antisense; TGGAGGTGCCCCATTGTGCGACTTA
>probe:Drosophila_2:1641208_s_at:239:507; Interrogation_Position=965; Antisense; GTGCGACTTACTTTGCTATTTTGTG
>probe:Drosophila_2:1641208_s_at:130:619; Interrogation_Position=978; Antisense; TGCTATTTTGTGTTTCTCTGGCCAA

Paste this into a BLAST search page for me
GTTTGCAGTCGAGAGGTCTTAACCATGAACCATGCAACCCTAAAGGCTTTAATCTGTTTTTCTCCATCATTAGCTAATTATTCCACAGACCATTGCTGAAGTAGTGAATAACTCGCACCTTTATATAAAAGTTAATGTGTGTGGCCGGCGCCGGCGCGTGAAGAATGGCAATTACTCGATGATCGCCGTGAACCAGCTGGTGAACCAGCTGGCTCATTTAGCCTCATTTAGCCTCCTTAATTATGCCACGTTATGCCACGATTTCGCTCATCCAATGGAGGTGCCCCATTGTGCGACTTAGTGCGACTTACTTTGCTATTTTGTGTGCTATTTTGTGTTTCTCTGGCCAA

Full Affymetrix probeset data:

Annotations for 1641208_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime