Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641211_at:

>probe:Drosophila_2:1641211_at:310:443; Interrogation_Position=1030; Antisense; GATGATTCGCAGCTTAGGAGCCTGT
>probe:Drosophila_2:1641211_at:22:349; Interrogation_Position=1080; Antisense; GCAGGAGTATAGCTCCACGCCGTTA
>probe:Drosophila_2:1641211_at:106:135; Interrogation_Position=1096; Antisense; ACGCCGTTACAGTTTGCCGGTGATT
>probe:Drosophila_2:1641211_at:260:61; Interrogation_Position=1145; Antisense; ATGGTGTACCACTAACGAGTCTCGG
>probe:Drosophila_2:1641211_at:19:533; Interrogation_Position=1171; Antisense; GGTGGCTATCCCGTGGAGCATGTCT
>probe:Drosophila_2:1641211_at:40:587; Interrogation_Position=1208; Antisense; TGGACAGCATTATCTCCGGGATAGT
>probe:Drosophila_2:1641211_at:222:677; Interrogation_Position=1229; Antisense; TAGTGTACAATCATCCTGCCTACGA
>probe:Drosophila_2:1641211_at:580:671; Interrogation_Position=1249; Antisense; TACGATCATTACTCCACCGAGGGCA
>probe:Drosophila_2:1641211_at:518:523; Interrogation_Position=1278; Antisense; GGTCGATCCGGAGCCAATTCAAAAG
>probe:Drosophila_2:1641211_at:426:211; Interrogation_Position=1324; Antisense; AAGAAACTCATCGATGGCCGGCTGG
>probe:Drosophila_2:1641211_at:354:201; Interrogation_Position=1412; Antisense; AACCCGCGAAGACCTATGGCTATAA
>probe:Drosophila_2:1641211_at:138:687; Interrogation_Position=1471; Antisense; TATAATGCGCCACCCATTACGGATT
>probe:Drosophila_2:1641211_at:648:655; Interrogation_Position=1487; Antisense; TTACGGATTACCTGAGGGCCTGGTT
>probe:Drosophila_2:1641211_at:263:213; Interrogation_Position=955; Antisense; AAGAGGGCCGCCTATGGTTACTATC

Paste this into a BLAST search page for me
GATGATTCGCAGCTTAGGAGCCTGTGCAGGAGTATAGCTCCACGCCGTTAACGCCGTTACAGTTTGCCGGTGATTATGGTGTACCACTAACGAGTCTCGGGGTGGCTATCCCGTGGAGCATGTCTTGGACAGCATTATCTCCGGGATAGTTAGTGTACAATCATCCTGCCTACGATACGATCATTACTCCACCGAGGGCAGGTCGATCCGGAGCCAATTCAAAAGAAGAAACTCATCGATGGCCGGCTGGAACCCGCGAAGACCTATGGCTATAATATAATGCGCCACCCATTACGGATTTTACGGATTACCTGAGGGCCTGGTTAAGAGGGCCGCCTATGGTTACTATC

Full Affymetrix probeset data:

Annotations for 1641211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime