Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641213_s_at:

>probe:Drosophila_2:1641213_s_at:133:187; Interrogation_Position=141; Antisense; AACAAGCGGCGCATTGTTCGCACGC
>probe:Drosophila_2:1641213_s_at:264:291; Interrogation_Position=167; Antisense; CGGTGGTCGTCTGGTTTACCAGTAT
>probe:Drosophila_2:1641213_s_at:476:297; Interrogation_Position=214; Antisense; CCCGTTGCGGCCAGTGCAAGGAGAA
>probe:Drosophila_2:1641213_s_at:631:205; Interrogation_Position=288; Antisense; AAGCGCCTGAAGACCGTGTCCAGGA
>probe:Drosophila_2:1641213_s_at:11:599; Interrogation_Position=304; Antisense; TGTCCAGGACCTACGGTGGAGTGCT
>probe:Drosophila_2:1641213_s_at:371:119; Interrogation_Position=336; Antisense; AGCTGCCTGCGCGAGCGTATCGTGC
>probe:Drosophila_2:1641213_s_at:600:227; Interrogation_Position=444; Antisense; AAGGCCAAGCCCGAGCCCAAGAAGA
>probe:Drosophila_2:1641213_s_at:478:375; Interrogation_Position=464; Antisense; GAAGAAGCCCGCTGCTGGAGCCAAG
>probe:Drosophila_2:1641213_s_at:196:651; Interrogation_Position=514; Antisense; TCACCAAGGGTGGTGCTGGCGCCAA
>probe:Drosophila_2:1641213_s_at:97:125; Interrogation_Position=572; Antisense; AGCCGCTGGCAAGCCCAGGAAGTAA
>probe:Drosophila_2:1641213_s_at:22:219; Interrogation_Position=591; Antisense; AAGTAAACAGCCCACGCAACGAGTT
>probe:Drosophila_2:1641213_s_at:300:359; Interrogation_Position=606; Antisense; GCAACGAGTTCGGTGTACTGCTAAA
>probe:Drosophila_2:1641213_s_at:222:685; Interrogation_Position=653; Antisense; TTTTCCAACTGGATTTACTGTTTGT
>probe:Drosophila_2:1641213_s_at:394:481; Interrogation_Position=676; Antisense; GTATTTTTAGTTTGACAGTCCAGTT

Paste this into a BLAST search page for me
AACAAGCGGCGCATTGTTCGCACGCCGGTGGTCGTCTGGTTTACCAGTATCCCGTTGCGGCCAGTGCAAGGAGAAAAGCGCCTGAAGACCGTGTCCAGGATGTCCAGGACCTACGGTGGAGTGCTAGCTGCCTGCGCGAGCGTATCGTGCAAGGCCAAGCCCGAGCCCAAGAAGAGAAGAAGCCCGCTGCTGGAGCCAAGTCACCAAGGGTGGTGCTGGCGCCAAAGCCGCTGGCAAGCCCAGGAAGTAAAAGTAAACAGCCCACGCAACGAGTTGCAACGAGTTCGGTGTACTGCTAAATTTTCCAACTGGATTTACTGTTTGTGTATTTTTAGTTTGACAGTCCAGTT

Full Affymetrix probeset data:

Annotations for 1641213_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime