FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641214_at:

>probe:Drosophila_2:1641214_at:123:107; Interrogation_Position=136; Antisense; AGAAGACCTTTACATACCCTCTGGA
>probe:Drosophila_2:1641214_at:378:641; Interrogation_Position=155; Antisense; TCTGGACTTGGTGCTGGACTACGAT
>probe:Drosophila_2:1641214_at:103:369; Interrogation_Position=185; Antisense; GAAGGTATCGGTCTCGTTCAACAGA
>probe:Drosophila_2:1641214_at:669:139; Interrogation_Position=250; Antisense; ACGGTATGCCCGTCAATGGAGTCAC
>probe:Drosophila_2:1641214_at:90:651; Interrogation_Position=271; Antisense; TCACCCTGGATGATGGACGCGATGT
>probe:Drosophila_2:1641214_at:83:557; Interrogation_Position=298; Antisense; GGACGACACTGGATGCACCGGAGAA
>probe:Drosophila_2:1641214_at:522:551; Interrogation_Position=317; Antisense; GGAGAACTATCCCATTAACCTGAAG
>probe:Drosophila_2:1641214_at:254:237; Interrogation_Position=374; Antisense; AATCTTTCTGGCCAGCATGTTCTAC
>probe:Drosophila_2:1641214_at:49:215; Interrogation_Position=438; Antisense; AAGAGTTCCGGCATCGAGATCCTAG
>probe:Drosophila_2:1641214_at:704:677; Interrogation_Position=460; Antisense; TAGAGGCGGACACTTTCACGCTGCA
>probe:Drosophila_2:1641214_at:266:281; Interrogation_Position=524; Antisense; CTCGGAAACGGGTCTCAATGGCATT
>probe:Drosophila_2:1641214_at:120:229; Interrogation_Position=540; Antisense; AATGGCATTGATCTGCTGCTGCGAA
>probe:Drosophila_2:1641214_at:699:333; Interrogation_Position=575; Antisense; GCTGTACTCAGACTACGTGCTCAAG
>probe:Drosophila_2:1641214_at:600:97; Interrogation_Position=619; Antisense; AGATGCCCATTCGATGCGAGCTCTT

Paste this into a BLAST search page for me
AGAAGACCTTTACATACCCTCTGGATCTGGACTTGGTGCTGGACTACGATGAAGGTATCGGTCTCGTTCAACAGAACGGTATGCCCGTCAATGGAGTCACTCACCCTGGATGATGGACGCGATGTGGACGACACTGGATGCACCGGAGAAGGAGAACTATCCCATTAACCTGAAGAATCTTTCTGGCCAGCATGTTCTACAAGAGTTCCGGCATCGAGATCCTAGTAGAGGCGGACACTTTCACGCTGCACTCGGAAACGGGTCTCAATGGCATTAATGGCATTGATCTGCTGCTGCGAAGCTGTACTCAGACTACGTGCTCAAGAGATGCCCATTCGATGCGAGCTCTT

Full Affymetrix probeset data:

Annotations for 1641214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720