Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641217_at:

>probe:Drosophila_2:1641217_at:62:519; Interrogation_Position=373; Antisense; GTGGTGCCGCCAGACATTGTAGACT
>probe:Drosophila_2:1641217_at:209:441; Interrogation_Position=412; Antisense; GATGTGGTTCGTTCCACGGGACAGA
>probe:Drosophila_2:1641217_at:589:557; Interrogation_Position=430; Antisense; GGACAGAACGTAACACTCACTTGCA
>probe:Drosophila_2:1641217_at:74:151; Interrogation_Position=448; Antisense; ACTTGCAGTGCAACGGGAGTGCCCA
>probe:Drosophila_2:1641217_at:195:207; Interrogation_Position=500; Antisense; AAGCGACTCCGATACTGATTTCAGA
>probe:Drosophila_2:1641217_at:128:111; Interrogation_Position=560; Antisense; AGAATCTCACCCTGTGGCAGGTGCA
>probe:Drosophila_2:1641217_at:500:255; Interrogation_Position=645; Antisense; CAAACGCGTCATGCTGGTGGTGAAT
>probe:Drosophila_2:1641217_at:727:363; Interrogation_Position=666; Antisense; GAATTTTGCGCCCACGATCTGGACA
>probe:Drosophila_2:1641217_at:372:135; Interrogation_Position=690; Antisense; ACGCTACGATACCATCTACGTGGGC
>probe:Drosophila_2:1641217_at:25:379; Interrogation_Position=723; Antisense; GAAGCTGACGCTGGAGTGCATCACA
>probe:Drosophila_2:1641217_at:388:289; Interrogation_Position=758; Antisense; CGGCATCGGTGAACTTCTGGCTGAG
>probe:Drosophila_2:1641217_at:99:641; Interrogation_Position=773; Antisense; TCTGGCTGAGGGATTCGCAATTGCT
>probe:Drosophila_2:1641217_at:371:75; Interrogation_Position=801; Antisense; AGGAGGTTCCTACGAGTCGGTCTCA
>probe:Drosophila_2:1641217_at:465:41; Interrogation_Position=932; Antisense; ATCGGATTATAACCGTGCACCGTAA

Paste this into a BLAST search page for me
GTGGTGCCGCCAGACATTGTAGACTGATGTGGTTCGTTCCACGGGACAGAGGACAGAACGTAACACTCACTTGCAACTTGCAGTGCAACGGGAGTGCCCAAAGCGACTCCGATACTGATTTCAGAAGAATCTCACCCTGTGGCAGGTGCACAAACGCGTCATGCTGGTGGTGAATGAATTTTGCGCCCACGATCTGGACAACGCTACGATACCATCTACGTGGGCGAAGCTGACGCTGGAGTGCATCACACGGCATCGGTGAACTTCTGGCTGAGTCTGGCTGAGGGATTCGCAATTGCTAGGAGGTTCCTACGAGTCGGTCTCAATCGGATTATAACCGTGCACCGTAA

Full Affymetrix probeset data:

Annotations for 1641217_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime