FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641219_at:

>probe:Drosophila_2:1641219_at:102:419; Interrogation_Position=1827; Antisense; GAGCTATCGATTTTGTCTGGTCATG
>probe:Drosophila_2:1641219_at:503:405; Interrogation_Position=1870; Antisense; GACTCGGAACTGAACATCGGCTGCT
>probe:Drosophila_2:1641219_at:665:89; Interrogation_Position=1949; Antisense; AGTATCAGCGACGTCCCTACTATAA
>probe:Drosophila_2:1641219_at:588:31; Interrogation_Position=1970; Antisense; ATAACGCCAATGAGCTGAAGCCCGA
>probe:Drosophila_2:1641219_at:69:15; Interrogation_Position=2018; Antisense; ATTACCAGGTGAATCAACGCCGCTT
>probe:Drosophila_2:1641219_at:662:299; Interrogation_Position=2035; Antisense; CGCCGCTTCAATTCGGTGGTAGGAA
>probe:Drosophila_2:1641219_at:468:373; Interrogation_Position=2057; Antisense; GAAGTCAACCGCAACAGACGCAGCA
>probe:Drosophila_2:1641219_at:668:359; Interrogation_Position=2079; Antisense; GCAATCGACTTTGCTGCACAGCTAC
>probe:Drosophila_2:1641219_at:26:341; Interrogation_Position=2099; Antisense; GCTACACGGTCATTGATTCGCTAAA
>probe:Drosophila_2:1641219_at:615:251; Interrogation_Position=2124; Antisense; CAAGAGCTTCTTGCCGGGACTGGGT
>probe:Drosophila_2:1641219_at:379:143; Interrogation_Position=2142; Antisense; ACTGGGTCTTGGAGTGCTGGTCACC
>probe:Drosophila_2:1641219_at:94:131; Interrogation_Position=2164; Antisense; ACCTCCGTGCTGGTTCTGATCTGGG
>probe:Drosophila_2:1641219_at:181:289; Interrogation_Position=2363; Antisense; CGGAAAATGGGACGCGCTACCTCAA
>probe:Drosophila_2:1641219_at:619:671; Interrogation_Position=2380; Antisense; TACCTCAAGCTGCAGGCAACGACGA

Paste this into a BLAST search page for me
GAGCTATCGATTTTGTCTGGTCATGGACTCGGAACTGAACATCGGCTGCTAGTATCAGCGACGTCCCTACTATAAATAACGCCAATGAGCTGAAGCCCGAATTACCAGGTGAATCAACGCCGCTTCGCCGCTTCAATTCGGTGGTAGGAAGAAGTCAACCGCAACAGACGCAGCAGCAATCGACTTTGCTGCACAGCTACGCTACACGGTCATTGATTCGCTAAACAAGAGCTTCTTGCCGGGACTGGGTACTGGGTCTTGGAGTGCTGGTCACCACCTCCGTGCTGGTTCTGATCTGGGCGGAAAATGGGACGCGCTACCTCAATACCTCAAGCTGCAGGCAACGACGA

Full Affymetrix probeset data:

Annotations for 1641219_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720