FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641220_at:

>probe:Drosophila_2:1641220_at:571:249; Interrogation_Position=1007; Antisense; CAATCTCCGTACTAAGCCCAAGTTA
>probe:Drosophila_2:1641220_at:577:675; Interrogation_Position=1034; Antisense; TAGCAGTGAAGCGATCCGGCGACCC
>probe:Drosophila_2:1641220_at:590:29; Interrogation_Position=1059; Antisense; ATAACTCCCGTGCTCAGCGTAAATT
>probe:Drosophila_2:1641220_at:402:213; Interrogation_Position=1131; Antisense; AAGAGCAAGGTGTCGTTGACCGCCC
>probe:Drosophila_2:1641220_at:282:321; Interrogation_Position=1152; Antisense; GCCCGAGCTGTGCAGGACATTGTCA
>probe:Drosophila_2:1641220_at:581:201; Interrogation_Position=1202; Antisense; AACCGGCACCGATGAGTTCGACTTG
>probe:Drosophila_2:1641220_at:459:53; Interrogation_Position=1237; Antisense; ATGCATACGGTGCTGGAGGCCATTT
>probe:Drosophila_2:1641220_at:177:263; Interrogation_Position=1327; Antisense; CAGCGGCCGGCTTGAACAGTAGTGA
>probe:Drosophila_2:1641220_at:728:187; Interrogation_Position=1341; Antisense; AACAGTAGTGATCGCACGGTGCGCT
>probe:Drosophila_2:1641220_at:403:403; Interrogation_Position=1371; Antisense; GAGGACGAAACCGAGGACTTTGACT
>probe:Drosophila_2:1641220_at:380:375; Interrogation_Position=1415; Antisense; GAAGAGTCCCATGTATCTGAGCCAC
>probe:Drosophila_2:1641220_at:444:429; Interrogation_Position=870; Antisense; GAGTTCGACTTTGAGGATGCCCACG
>probe:Drosophila_2:1641220_at:7:79; Interrogation_Position=928; Antisense; AGGTTCAGAACCAAAGCCGCGCTCA
>probe:Drosophila_2:1641220_at:590:321; Interrogation_Position=946; Antisense; GCGCTCATAACCAGTCCAGTGTCAG

Paste this into a BLAST search page for me
CAATCTCCGTACTAAGCCCAAGTTATAGCAGTGAAGCGATCCGGCGACCCATAACTCCCGTGCTCAGCGTAAATTAAGAGCAAGGTGTCGTTGACCGCCCGCCCGAGCTGTGCAGGACATTGTCAAACCGGCACCGATGAGTTCGACTTGATGCATACGGTGCTGGAGGCCATTTCAGCGGCCGGCTTGAACAGTAGTGAAACAGTAGTGATCGCACGGTGCGCTGAGGACGAAACCGAGGACTTTGACTGAAGAGTCCCATGTATCTGAGCCACGAGTTCGACTTTGAGGATGCCCACGAGGTTCAGAACCAAAGCCGCGCTCAGCGCTCATAACCAGTCCAGTGTCAG

Full Affymetrix probeset data:

Annotations for 1641220_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720