FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641221_at:

>probe:Drosophila_2:1641221_at:645:561; Interrogation_Position=156; Antisense; GGAACGACAACGAACTCTTCTGCGG
>probe:Drosophila_2:1641221_at:616:573; Interrogation_Position=179; Antisense; GGCGGTTTGTACACGCAGTCCAACA
>probe:Drosophila_2:1641221_at:712:499; Interrogation_Position=219; Antisense; GTCTGTGCGGCGACAACTTCCTGGA
>probe:Drosophila_2:1641221_at:320:553; Interrogation_Position=303; Antisense; GGAGCTACGTGGCTGGCAATACCAT
>probe:Drosophila_2:1641221_at:601:361; Interrogation_Position=318; Antisense; GCAATACCATCACCGTGGGCGTGAA
>probe:Drosophila_2:1641221_at:559:373; Interrogation_Position=340; Antisense; GAAGATCACCACCAATCACTTGGGT
>probe:Drosophila_2:1641221_at:259:475; Interrogation_Position=363; Antisense; GTTACTTCGAGTTCCACCTGTGCAA
>probe:Drosophila_2:1641221_at:137:437; Interrogation_Position=413; Antisense; GAGGAGTGCTTCGATCAGAACCGCC
>probe:Drosophila_2:1641221_at:218:201; Interrogation_Position=431; Antisense; AACCGCCTGCGATTCATCGATGGAA
>probe:Drosophila_2:1641221_at:73:247; Interrogation_Position=489; Antisense; AATTCGATGTGACAGTCGTCCTGCC
>probe:Drosophila_2:1641221_at:661:331; Interrogation_Position=546; Antisense; GCTGGACCTATGTGGGTGCCAACAA
>probe:Drosophila_2:1641221_at:27:525; Interrogation_Position=574; Antisense; GGGCATCTGCGATAATTCCGGAAAC
>probe:Drosophila_2:1641221_at:328:1; Interrogation_Position=589; Antisense; TTCCGGAAACGGAGCCTTGGGCTGT
>probe:Drosophila_2:1641221_at:479:211; Interrogation_Position=632; Antisense; AAGAACTGCGCCGATGTGAGCATCT

Paste this into a BLAST search page for me
GGAACGACAACGAACTCTTCTGCGGGGCGGTTTGTACACGCAGTCCAACAGTCTGTGCGGCGACAACTTCCTGGAGGAGCTACGTGGCTGGCAATACCATGCAATACCATCACCGTGGGCGTGAAGAAGATCACCACCAATCACTTGGGTGTTACTTCGAGTTCCACCTGTGCAAGAGGAGTGCTTCGATCAGAACCGCCAACCGCCTGCGATTCATCGATGGAAAATTCGATGTGACAGTCGTCCTGCCGCTGGACCTATGTGGGTGCCAACAAGGGCATCTGCGATAATTCCGGAAACTTCCGGAAACGGAGCCTTGGGCTGTAAGAACTGCGCCGATGTGAGCATCT

Full Affymetrix probeset data:

Annotations for 1641221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720