FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641222_at:

>probe:Drosophila_2:1641222_at:17:85; Interrogation_Position=172; Antisense; AGTGGAGCCGCTTCTGCTGGCAGTA
>probe:Drosophila_2:1641222_at:123:721; Interrogation_Position=257; Antisense; TTGCCTACGCCAACGAGTACAAGGA
>probe:Drosophila_2:1641222_at:46:667; Interrogation_Position=301; Antisense; TACACCAAGTACATGCAGGCCCAGT
>probe:Drosophila_2:1641222_at:503:73; Interrogation_Position=357; Antisense; AGGTGGTTTTGGCATCGACTCCGAT
>probe:Drosophila_2:1641222_at:509:601; Interrogation_Position=383; Antisense; TGTTTGGCACATCTATAGGTCTCGA
>probe:Drosophila_2:1641222_at:640:535; Interrogation_Position=400; Antisense; GGTCTCGATGAGAACGCCAACATAG
>probe:Drosophila_2:1641222_at:133:521; Interrogation_Position=424; Antisense; GTGGACAAGTACTCCGATCTACTCA
>probe:Drosophila_2:1641222_at:539:537; Interrogation_Position=47; Antisense; GGTACAGCGACATAACCGTCACGGC
>probe:Drosophila_2:1641222_at:236:503; Interrogation_Position=475; Antisense; GTGCCGACCACGATGGCGGGTTTAA
>probe:Drosophila_2:1641222_at:574:657; Interrogation_Position=497; Antisense; TAAGGGCACCCAAGGAGCGCATGCA
>probe:Drosophila_2:1641222_at:488:53; Interrogation_Position=517; Antisense; ATGCAGCGCGATATAGCCCATGCCA
>probe:Drosophila_2:1641222_at:150:373; Interrogation_Position=546; Antisense; GAAGGTGCGCCAGTGTCTTCAGCTC
>probe:Drosophila_2:1641222_at:359:77; Interrogation_Position=584; Antisense; AGGAGGAGACCGATCAGACTGACTT
>probe:Drosophila_2:1641222_at:142:555; Interrogation_Position=99; Antisense; GGAGCCAGCAATGGACACCAACCAG

Paste this into a BLAST search page for me
AGTGGAGCCGCTTCTGCTGGCAGTATTGCCTACGCCAACGAGTACAAGGATACACCAAGTACATGCAGGCCCAGTAGGTGGTTTTGGCATCGACTCCGATTGTTTGGCACATCTATAGGTCTCGAGGTCTCGATGAGAACGCCAACATAGGTGGACAAGTACTCCGATCTACTCAGGTACAGCGACATAACCGTCACGGCGTGCCGACCACGATGGCGGGTTTAATAAGGGCACCCAAGGAGCGCATGCAATGCAGCGCGATATAGCCCATGCCAGAAGGTGCGCCAGTGTCTTCAGCTCAGGAGGAGACCGATCAGACTGACTTGGAGCCAGCAATGGACACCAACCAG

Full Affymetrix probeset data:

Annotations for 1641222_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720