FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641223_at:

>probe:Drosophila_2:1641223_at:371:63; Interrogation_Position=1015; Antisense; ATGTGACTCAGCGATTTCGAACGGA
>probe:Drosophila_2:1641223_at:372:645; Interrogation_Position=1051; Antisense; TCAGCTGGCGGGATGACTAATCACC
>probe:Drosophila_2:1641223_at:441:383; Interrogation_Position=1080; Antisense; GAACTTATTTCTGTGCATCGTTTGT
>probe:Drosophila_2:1641223_at:423:475; Interrogation_Position=592; Antisense; GTTATATTAAACTGCCCTATGTGGT
>probe:Drosophila_2:1641223_at:89:223; Interrogation_Position=618; Antisense; AAGGGCATGGATGTCAGCTTCTCGG
>probe:Drosophila_2:1641223_at:303:537; Interrogation_Position=719; Antisense; GGTCAATAATTACAGCCAAGCCGAT
>probe:Drosophila_2:1641223_at:448:205; Interrogation_Position=736; Antisense; AAGCCGATCTTTGCTATTCGCTGCA
>probe:Drosophila_2:1641223_at:672:689; Interrogation_Position=750; Antisense; TATTCGCTGCAGGAGACCATCTTCG
>probe:Drosophila_2:1641223_at:573:129; Interrogation_Position=765; Antisense; ACCATCTTCGCCATGTTGGTGGAGA
>probe:Drosophila_2:1641223_at:426:551; Interrogation_Position=785; Antisense; GGAGATCACAGAGCGCGCCATGGCA
>probe:Drosophila_2:1641223_at:49:567; Interrogation_Position=806; Antisense; GGCACACTGCGGCTCAAATGAGGTC
>probe:Drosophila_2:1641223_at:604:255; Interrogation_Position=905; Antisense; CAAACTCTTTGCCACTGATGAACGT
>probe:Drosophila_2:1641223_at:136:197; Interrogation_Position=942; Antisense; AACGGACTAATGATTGCCCATGCTG
>probe:Drosophila_2:1641223_at:550:165; Interrogation_Position=973; Antisense; AAATGTTCCGCTCTGGCACTAGGAT

Paste this into a BLAST search page for me
ATGTGACTCAGCGATTTCGAACGGATCAGCTGGCGGGATGACTAATCACCGAACTTATTTCTGTGCATCGTTTGTGTTATATTAAACTGCCCTATGTGGTAAGGGCATGGATGTCAGCTTCTCGGGGTCAATAATTACAGCCAAGCCGATAAGCCGATCTTTGCTATTCGCTGCATATTCGCTGCAGGAGACCATCTTCGACCATCTTCGCCATGTTGGTGGAGAGGAGATCACAGAGCGCGCCATGGCAGGCACACTGCGGCTCAAATGAGGTCCAAACTCTTTGCCACTGATGAACGTAACGGACTAATGATTGCCCATGCTGAAATGTTCCGCTCTGGCACTAGGAT

Full Affymetrix probeset data:

Annotations for 1641223_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720