FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641225_at:

>probe:Drosophila_2:1641225_at:277:475; Interrogation_Position=1133; Antisense; GTTACTTCCAGCCTATCAACGAGAA
>probe:Drosophila_2:1641225_at:456:197; Interrogation_Position=1150; Antisense; AACGAGAACTTCATCTGCGCAGGAT
>probe:Drosophila_2:1641225_at:667:287; Interrogation_Position=1211; Antisense; CTGGCGGTCCTTTGATGATGCGATA
>probe:Drosophila_2:1641225_at:721:445; Interrogation_Position=1227; Antisense; GATGCGATATGATTCCCACTGGGTT
>probe:Drosophila_2:1641225_at:292:549; Interrogation_Position=1258; Antisense; GGAGTGGTGTCCTTTGGCAACAAGT
>probe:Drosophila_2:1641225_at:440:317; Interrogation_Position=1290; Antisense; GCCGGGATATCCAGGTGTCTATACT
>probe:Drosophila_2:1641225_at:687:27; Interrogation_Position=1326; Antisense; ATACCTTGACTGGATACGCGATCAC
>probe:Drosophila_2:1641225_at:582:71; Interrogation_Position=1354; Antisense; AGGGATTAATCGCATTCCCGTTCCA
>probe:Drosophila_2:1641225_at:202:267; Interrogation_Position=793; Antisense; CAGTTTACGGTTCGCTTGGGTGACA
>probe:Drosophila_2:1641225_at:127:451; Interrogation_Position=820; Antisense; GATCTGTCAACGGATGCGGAACCCT
>probe:Drosophila_2:1641225_at:156:73; Interrogation_Position=869; Antisense; AGGAAGTGCGCACCCATGAGCGATT
>probe:Drosophila_2:1641225_at:668:55; Interrogation_Position=884; Antisense; ATGAGCGATTCTCCCGCATTGGATT
>probe:Drosophila_2:1641225_at:394:53; Interrogation_Position=914; Antisense; ATGACATTGCCATCCTTGTTTTGGA
>probe:Drosophila_2:1641225_at:550:169; Interrogation_Position=957; Antisense; AAAGTATGTAATCCCTGTCTGCCTG

Paste this into a BLAST search page for me
GTTACTTCCAGCCTATCAACGAGAAAACGAGAACTTCATCTGCGCAGGATCTGGCGGTCCTTTGATGATGCGATAGATGCGATATGATTCCCACTGGGTTGGAGTGGTGTCCTTTGGCAACAAGTGCCGGGATATCCAGGTGTCTATACTATACCTTGACTGGATACGCGATCACAGGGATTAATCGCATTCCCGTTCCACAGTTTACGGTTCGCTTGGGTGACAGATCTGTCAACGGATGCGGAACCCTAGGAAGTGCGCACCCATGAGCGATTATGAGCGATTCTCCCGCATTGGATTATGACATTGCCATCCTTGTTTTGGAAAAGTATGTAATCCCTGTCTGCCTG

Full Affymetrix probeset data:

Annotations for 1641225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720