Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641228_a_at:

>probe:Drosophila_2:1641228_a_at:663:27; Interrogation_Position=324; Antisense; ATACGGACTGCGATGGACTGATCTC
>probe:Drosophila_2:1641228_a_at:49:373; Interrogation_Position=349; Antisense; GAAGGATGATCTACGGTTCACCTAC
>probe:Drosophila_2:1641228_a_at:435:541; Interrogation_Position=363; Antisense; GGTTCACCTACACGGCGCTGGGCAA
>probe:Drosophila_2:1641228_a_at:255:135; Interrogation_Position=387; Antisense; ACGAACCGAACGAACAGCTACTGGA
>probe:Drosophila_2:1641228_a_at:729:223; Interrogation_Position=431; Antisense; AAGGAGCCGCTCGACTATGAAGCCT
>probe:Drosophila_2:1641228_a_at:567:379; Interrogation_Position=449; Antisense; GAAGCCTTCGTTCGGCTGATGAGTC
>probe:Drosophila_2:1641228_a_at:49:609; Interrogation_Position=468; Antisense; TGAGTCGTCGCACCCAGGAACTGGA
>probe:Drosophila_2:1641228_a_at:462:57; Interrogation_Position=501; Antisense; ATGTTTTGTTGGAGGCCTGGAGCAA
>probe:Drosophila_2:1641228_a_at:659:229; Interrogation_Position=525; Antisense; AATGGGATGACCATGGCACGGGCAA
>probe:Drosophila_2:1641228_a_at:559:565; Interrogation_Position=539; Antisense; GGCACGGGCAAGATCGACGAACGCA
>probe:Drosophila_2:1641228_a_at:493:35; Interrogation_Position=628; Antisense; ATCTATGAAGAGCTGACCAACTATG
>probe:Drosophila_2:1641228_a_at:217:533; Interrogation_Position=652; Antisense; GGTGACAAAATGACCCTCAACGAGG
>probe:Drosophila_2:1641228_a_at:587:547; Interrogation_Position=723; Antisense; GGAGGAGCCGCCCATGATCGATTAC
>probe:Drosophila_2:1641228_a_at:536:315; Interrogation_Position=751; Antisense; GCCTTCTGTCGCATGCTAAGTGGAA

Paste this into a BLAST search page for me
ATACGGACTGCGATGGACTGATCTCGAAGGATGATCTACGGTTCACCTACGGTTCACCTACACGGCGCTGGGCAAACGAACCGAACGAACAGCTACTGGAAAGGAGCCGCTCGACTATGAAGCCTGAAGCCTTCGTTCGGCTGATGAGTCTGAGTCGTCGCACCCAGGAACTGGAATGTTTTGTTGGAGGCCTGGAGCAAAATGGGATGACCATGGCACGGGCAAGGCACGGGCAAGATCGACGAACGCAATCTATGAAGAGCTGACCAACTATGGGTGACAAAATGACCCTCAACGAGGGGAGGAGCCGCCCATGATCGATTACGCCTTCTGTCGCATGCTAAGTGGAA

Full Affymetrix probeset data:

Annotations for 1641228_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime