Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641229_at:

>probe:Drosophila_2:1641229_at:352:45; Interrogation_Position=13; Antisense; ATCCAGTCTTTCGATTAACTTTGAC
>probe:Drosophila_2:1641229_at:180:341; Interrogation_Position=151; Antisense; GCTACGGGCTCAAGCACTTCGACAA
>probe:Drosophila_2:1641229_at:245:121; Interrogation_Position=232; Antisense; AGCGATTCGTCCACCAGTTCCAGCA
>probe:Drosophila_2:1641229_at:318:675; Interrogation_Position=267; Antisense; TAGCTCCAGCAGTTCATCCAAGAAG
>probe:Drosophila_2:1641229_at:570:601; Interrogation_Position=34; Antisense; TGACTCAATATGAAGCTCCACTGGC
>probe:Drosophila_2:1641229_at:111:77; Interrogation_Position=346; Antisense; AGGAGACGTGCTGCTGCCGCTCGCA
>probe:Drosophila_2:1641229_at:352:473; Interrogation_Position=398; Antisense; GTTAGACTGGAAACCGCGATTGGAG
>probe:Drosophila_2:1641229_at:645:577; Interrogation_Position=468; Antisense; GGCCTAGACAGGACTTTCAACGTTT
>probe:Drosophila_2:1641229_at:307:337; Interrogation_Position=48; Antisense; GCTCCACTGGCTGCTATTAGCAGTC
>probe:Drosophila_2:1641229_at:642:187; Interrogation_Position=503; Antisense; AACACTCTCTGTTGATCCTCGGGAT
>probe:Drosophila_2:1641229_at:257:447; Interrogation_Position=516; Antisense; GATCCTCGGGATCGCCAATTTAATA
>probe:Drosophila_2:1641229_at:419:687; Interrogation_Position=539; Antisense; TATATTCCCGGCTATGGTTATTGCA
>probe:Drosophila_2:1641229_at:74:707; Interrogation_Position=64; Antisense; TTAGCAGTCGTACTGATCTGTGCCC
>probe:Drosophila_2:1641229_at:197:41; Interrogation_Position=79; Antisense; ATCTGTGCCCTGTACAGCGCTACGG

Paste this into a BLAST search page for me
ATCCAGTCTTTCGATTAACTTTGACGCTACGGGCTCAAGCACTTCGACAAAGCGATTCGTCCACCAGTTCCAGCATAGCTCCAGCAGTTCATCCAAGAAGTGACTCAATATGAAGCTCCACTGGCAGGAGACGTGCTGCTGCCGCTCGCAGTTAGACTGGAAACCGCGATTGGAGGGCCTAGACAGGACTTTCAACGTTTGCTCCACTGGCTGCTATTAGCAGTCAACACTCTCTGTTGATCCTCGGGATGATCCTCGGGATCGCCAATTTAATATATATTCCCGGCTATGGTTATTGCATTAGCAGTCGTACTGATCTGTGCCCATCTGTGCCCTGTACAGCGCTACGG

Full Affymetrix probeset data:

Annotations for 1641229_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime