FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641230_at:

>probe:Drosophila_2:1641230_at:112:249; Interrogation_Position=173; Antisense; AATTGATGGTGTATCCGGGCGCCGA
>probe:Drosophila_2:1641230_at:270:101; Interrogation_Position=246; Antisense; AGAGGTGACATTGCCGGAGGCCAAC
>probe:Drosophila_2:1641230_at:595:157; Interrogation_Position=269; Antisense; ACACACCGGCGGATGACAAGCGAGC
>probe:Drosophila_2:1641230_at:285:437; Interrogation_Position=325; Antisense; GAGGAGATTTTTAGTGCCCCAGCCG
>probe:Drosophila_2:1641230_at:279:407; Interrogation_Position=361; Antisense; GACGAGTATCCGATGGTGGTTCCCA
>probe:Drosophila_2:1641230_at:691:531; Interrogation_Position=375; Antisense; GGTGGTTCCCAAGCGTGCAGCATTA
>probe:Drosophila_2:1641230_at:676:351; Interrogation_Position=391; Antisense; GCAGCATTACTTTTGGATCGTCTTA
>probe:Drosophila_2:1641230_at:490:451; Interrogation_Position=406; Antisense; GATCGTCTTATGGTTGCTTTGCATC
>probe:Drosophila_2:1641230_at:672:707; Interrogation_Position=493; Antisense; TTAAGTGGCAAATTCGGCGATTCGC
>probe:Drosophila_2:1641230_at:352:693; Interrogation_Position=606; Antisense; TTTGAACCAGATCAATCGCGCCACT
>probe:Drosophila_2:1641230_at:607:389; Interrogation_Position=634; Antisense; GAAACACTGGTAGCCGGCGTATCCA
>probe:Drosophila_2:1641230_at:170:417; Interrogation_Position=682; Antisense; GAGCGTACTGGCGTTGCTATTTCAA
>probe:Drosophila_2:1641230_at:604:49; Interrogation_Position=706; Antisense; ATGCCGTCAGCTGCTTTTAAACAAA
>probe:Drosophila_2:1641230_at:703:345; Interrogation_Position=743; Antisense; GCATAAAAGTCGTCTCTGGAGTGGA

Paste this into a BLAST search page for me
AATTGATGGTGTATCCGGGCGCCGAAGAGGTGACATTGCCGGAGGCCAACACACACCGGCGGATGACAAGCGAGCGAGGAGATTTTTAGTGCCCCAGCCGGACGAGTATCCGATGGTGGTTCCCAGGTGGTTCCCAAGCGTGCAGCATTAGCAGCATTACTTTTGGATCGTCTTAGATCGTCTTATGGTTGCTTTGCATCTTAAGTGGCAAATTCGGCGATTCGCTTTGAACCAGATCAATCGCGCCACTGAAACACTGGTAGCCGGCGTATCCAGAGCGTACTGGCGTTGCTATTTCAAATGCCGTCAGCTGCTTTTAAACAAAGCATAAAAGTCGTCTCTGGAGTGGA

Full Affymetrix probeset data:

Annotations for 1641230_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720