Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641232_s_at:

>probe:Drosophila_2:1641232_s_at:356:229; Interrogation_Position=130; Antisense; AATTTCAAAGCCACCTTCAATTCCT
>probe:Drosophila_2:1641232_s_at:309:537; Interrogation_Position=189; Antisense; GGTAGGCGTCATCTTAATATCCAAC
>probe:Drosophila_2:1641232_s_at:665:35; Interrogation_Position=250; Antisense; ATCATGAACTTGCACAGCGTCGTCG
>probe:Drosophila_2:1641232_s_at:439:567; Interrogation_Position=274; Antisense; GGCAGAGTTTACGTGCAGCCGGAAA
>probe:Drosophila_2:1641232_s_at:588:509; Interrogation_Position=286; Antisense; GTGCAGCCGGAAACGCTGTCAAGTT
>probe:Drosophila_2:1641232_s_at:180:573; Interrogation_Position=337; Antisense; GGCTGGGTGGAGTTCATTTCGAAAA
>probe:Drosophila_2:1641232_s_at:289:31; Interrogation_Position=403; Antisense; ATAACCGATGGCAAGTCGTCCCGAT
>probe:Drosophila_2:1641232_s_at:292:293; Interrogation_Position=424; Antisense; CGATTCCGTGGCTTGCTGTGGAAAA
>probe:Drosophila_2:1641232_s_at:74:161; Interrogation_Position=446; Antisense; AAATGAAGTTCCTGCCACGCTTCAA
>probe:Drosophila_2:1641232_s_at:392:539; Interrogation_Position=473; Antisense; GGTACTATCTAACCGATCGCATGGA
>probe:Drosophila_2:1641232_s_at:505:557; Interrogation_Position=495; Antisense; GGACTACGAGCTGGCGGTTTGCAAA
>probe:Drosophila_2:1641232_s_at:385:169; Interrogation_Position=517; Antisense; AAAGTTCGCGTATGGTCGCAGGCCC
>probe:Drosophila_2:1641232_s_at:150:487; Interrogation_Position=561; Antisense; GTACGATCCCGACCAGATGGAGTAT
>probe:Drosophila_2:1641232_s_at:329:309; Interrogation_Position=647; Antisense; CCAGGAATGCGGAGATGGCTGCCAA

Paste this into a BLAST search page for me
AATTTCAAAGCCACCTTCAATTCCTGGTAGGCGTCATCTTAATATCCAACATCATGAACTTGCACAGCGTCGTCGGGCAGAGTTTACGTGCAGCCGGAAAGTGCAGCCGGAAACGCTGTCAAGTTGGCTGGGTGGAGTTCATTTCGAAAAATAACCGATGGCAAGTCGTCCCGATCGATTCCGTGGCTTGCTGTGGAAAAAAATGAAGTTCCTGCCACGCTTCAAGGTACTATCTAACCGATCGCATGGAGGACTACGAGCTGGCGGTTTGCAAAAAAGTTCGCGTATGGTCGCAGGCCCGTACGATCCCGACCAGATGGAGTATCCAGGAATGCGGAGATGGCTGCCAA

Full Affymetrix probeset data:

Annotations for 1641232_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime