Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641235_at:

>probe:Drosophila_2:1641235_at:648:383; Interrogation_Position=1484; Antisense; GAACTCATCCTCCTTTATTTTGTAA
>probe:Drosophila_2:1641235_at:228:605; Interrogation_Position=1521; Antisense; TGATCGGAACGATTGGCCCATCTGT
>probe:Drosophila_2:1641235_at:67:271; Interrogation_Position=1539; Antisense; CATCTGTGCCAGTCCATGATTATTA
>probe:Drosophila_2:1641235_at:176:547; Interrogation_Position=1572; Antisense; GGATGAACCGTTTCCAGACGAAAAT
>probe:Drosophila_2:1641235_at:226:411; Interrogation_Position=1588; Antisense; GACGAAAATCAAACGCCGGGTGCCA
>probe:Drosophila_2:1641235_at:272:31; Interrogation_Position=1617; Antisense; ATACAAGTGGCATGCGAGTCCGCGA
>probe:Drosophila_2:1641235_at:137:433; Interrogation_Position=1632; Antisense; GAGTCCGCGAAGAACTGCTGAGCTA
>probe:Drosophila_2:1641235_at:725:403; Interrogation_Position=1737; Antisense; GACTCTACCAGCAAGTTTTCCATTT
>probe:Drosophila_2:1641235_at:374:459; Interrogation_Position=1766; Antisense; GATTTTTTCCCTTGAAGTGTGCCTG
>probe:Drosophila_2:1641235_at:128:23; Interrogation_Position=1857; Antisense; ATATAGTGCTTGGTAGCTCACCCTG
>probe:Drosophila_2:1641235_at:393:513; Interrogation_Position=1881; Antisense; GTGATGCACCCGACTAACAAAACTC
>probe:Drosophila_2:1641235_at:237:179; Interrogation_Position=1900; Antisense; AAACTCCGCCGACGCAAAATGACCG
>probe:Drosophila_2:1641235_at:194:297; Interrogation_Position=1973; Antisense; CGCTACTAATACGTTTTCCATGAAT
>probe:Drosophila_2:1641235_at:696:239; Interrogation_Position=2015; Antisense; AATTAGGAGCATGCACCGGTAACCA

Paste this into a BLAST search page for me
GAACTCATCCTCCTTTATTTTGTAATGATCGGAACGATTGGCCCATCTGTCATCTGTGCCAGTCCATGATTATTAGGATGAACCGTTTCCAGACGAAAATGACGAAAATCAAACGCCGGGTGCCAATACAAGTGGCATGCGAGTCCGCGAGAGTCCGCGAAGAACTGCTGAGCTAGACTCTACCAGCAAGTTTTCCATTTGATTTTTTCCCTTGAAGTGTGCCTGATATAGTGCTTGGTAGCTCACCCTGGTGATGCACCCGACTAACAAAACTCAAACTCCGCCGACGCAAAATGACCGCGCTACTAATACGTTTTCCATGAATAATTAGGAGCATGCACCGGTAACCA

Full Affymetrix probeset data:

Annotations for 1641235_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime